EMAIL THIS PAGE TO A FRIEND

CNTRL

centriolin

140 Gene Product Result for
Synonyms: CEP1 CEP110 FAN bA165P4.1
Gene ID:
Human(11064) Summary: This gene encodes a centrosomal protein required for the centrosome to function as a microtubule organizing center. The gene product is also associated with centrosome maturation. One version of stem cell myeloproliferative disorder is the result of a reciprocal translocation between chromosomes 8 and 9, with the breakpoint associated with fibroblast growth factor receptor 1 and centrosomal protein 1. [provided by RefSeq, Jul 2008]
Rat(311886) centriolin
sheep(101115515) centriolin
chicken(417121) centriolin
cow(520186) centriolin
dog(474817) centriolin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007018 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007018 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007018 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU028091 MISSION® esiRNA esiRNA human CEP110 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007018 Rosetta Predictions human pricing
NM_001107836 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007018 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00342779 predicted 5256
2 SASI_Hs02_00342780 predicted 4093
3 SASI_Hs01_00167165 predicted 1754
4 SASI_Hs01_00167166 predicted 5556
5 SASI_Hs01_00167167 predicted 1742
6 SASI_Hs01_00167168 predicted 4224
7 SASI_Hs01_00167169 predicted 573
8 SASI_Hs01_00167170 predicted 6798
9 SASI_Hs01_00167173 predicted 2219
10 SASI_Hs01_00167174 predicted 4169
11 SASI_Hs01_00167171 predicted 7009
12 SASI_Hs01_00167172 predicted 1001
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107836 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00232755 predicted 3681
2 SASI_Rn02_00232756 predicted 3372
3 SASI_Rn02_00232757 predicted 613
4 SASI_Rn02_00232758 predicted 1314
5 SASI_Rn02_00232759 predicted 1257
6 SASI_Rn02_00232760 predicted 2876
7 SASI_Rn02_00232761 predicted 380
8 SASI_Rn02_00232762 predicted 855
9 SASI_Rn02_00232763 predicted 3154
10 SASI_Rn02_00232764 predicted 1895
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007018
CNTRL MISSION shRNA Bacterial Glycerol Stock
centriolin
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007018.4-2767s21c1
Sequence:CCGGGGAGAATGAAATTCACTATTTCTCGAGAAATAGTGAATTTCATTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007018.4-479s21c1
Sequence:CCGGCGTGAACTCAACTTATCATATCTCGAGATATGATAAGTTGAGTTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007018.4-645s21c1
Sequence:CCGGTATCATCGCTCCAAGATATAACTCGAGTTATATCTTGGAGCGATGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007018.4-1118s21c1
Sequence:CCGGGCTAAATTTGAGCCACTAAATCTCGAGATTTAGTGGCTCAAATTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007018.4-416s21c1
Sequence:CCGGGTACTGAATCTCAGCTATAATCTCGAGATTATAGCTGAGATTCAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007018.4-3643s21c1
Sequence:CCGGCATCAGGAGTGGGTTACATAACTCGAGTTATGTAACCCACTCCTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007018.4-276s21c1
Sequence:CCGGATATTACAGAGGCCCTCATTACTCGAGTAATGAGGGCCTCTGTAATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007018.4-5307s21c1
Sequence:CCGGAGCTCCTTGAGAGGGATAAACCTCGAGGTTTATCCCTCTCAAGGAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007018.4-1372s21c1
Sequence:CCGGTGCAGCACAAACTCGACTATCCTCGAGGATAGTCGAGTTTGTGCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007018.3-6093s1c1
Sequence:CCGGCCCAAACTAAACGGCAGCTTTCTCGAGAAAGCTGCCGTTTAGTTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007018.3-1856s1c1
Sequence:CCGGGCCCTGAAGAAGGATTTAGAACTCGAGTTCTAAATCCTTCTTCAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007018.3-622s1c1
Sequence:CCGGCCTCAATTTGAAAGGCAACAACTCGAGTTGTTGCCTTTCAAATTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007018.3-4630s1c1
Sequence:CCGGCCAATGTTTAAGCAAGAAGAACTCGAGTTCTTCTTGCTTAAACATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007018
CNTRL MISSION shRNA shRNA Plasmid DNA
centriolin
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007018.4-2767s21c1
Sequence:CCGGGGAGAATGAAATTCACTATTTCTCGAGAAATAGTGAATTTCATTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007018.4-479s21c1
Sequence:CCGGCGTGAACTCAACTTATCATATCTCGAGATATGATAAGTTGAGTTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007018.4-645s21c1
Sequence:CCGGTATCATCGCTCCAAGATATAACTCGAGTTATATCTTGGAGCGATGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007018.4-1118s21c1
Sequence:CCGGGCTAAATTTGAGCCACTAAATCTCGAGATTTAGTGGCTCAAATTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007018.4-416s21c1
Sequence:CCGGGTACTGAATCTCAGCTATAATCTCGAGATTATAGCTGAGATTCAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007018.4-3643s21c1
Sequence:CCGGCATCAGGAGTGGGTTACATAACTCGAGTTATGTAACCCACTCCTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007018.4-276s21c1
Sequence:CCGGATATTACAGAGGCCCTCATTACTCGAGTAATGAGGGCCTCTGTAATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007018.4-5307s21c1
Sequence:CCGGAGCTCCTTGAGAGGGATAAACCTCGAGGTTTATCCCTCTCAAGGAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007018.4-1372s21c1
Sequence:CCGGTGCAGCACAAACTCGACTATCCTCGAGGATAGTCGAGTTTGTGCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007018.3-6093s1c1
Sequence:CCGGCCCAAACTAAACGGCAGCTTTCTCGAGAAAGCTGCCGTTTAGTTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007018.3-1856s1c1
Sequence:CCGGGCCCTGAAGAAGGATTTAGAACTCGAGTTCTAAATCCTTCTTCAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007018.3-622s1c1
Sequence:CCGGCCTCAATTTGAAAGGCAACAACTCGAGTTGTTGCCTTTCAAATTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007018.3-4630s1c1
Sequence:CCGGCCAATGTTTAAGCAAGAAGAACTCGAGTTCTTCTTGCTTAAACATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007018
CNTRL MISSION shRNA Lentiviral Transduction Particles
centriolin
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007018.4-2767s21c1
Sequence:CCGGGGAGAATGAAATTCACTATTTCTCGAGAAATAGTGAATTTCATTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007018.4-479s21c1
Sequence:CCGGCGTGAACTCAACTTATCATATCTCGAGATATGATAAGTTGAGTTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007018.4-645s21c1
Sequence:CCGGTATCATCGCTCCAAGATATAACTCGAGTTATATCTTGGAGCGATGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007018.4-1118s21c1
Sequence:CCGGGCTAAATTTGAGCCACTAAATCTCGAGATTTAGTGGCTCAAATTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007018.4-416s21c1
Sequence:CCGGGTACTGAATCTCAGCTATAATCTCGAGATTATAGCTGAGATTCAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007018.4-3643s21c1
Sequence:CCGGCATCAGGAGTGGGTTACATAACTCGAGTTATGTAACCCACTCCTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007018.4-276s21c1
Sequence:CCGGATATTACAGAGGCCCTCATTACTCGAGTAATGAGGGCCTCTGTAATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007018.4-5307s21c1
Sequence:CCGGAGCTCCTTGAGAGGGATAAACCTCGAGGTTTATCCCTCTCAAGGAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007018.4-1372s21c1
Sequence:CCGGTGCAGCACAAACTCGACTATCCTCGAGGATAGTCGAGTTTGTGCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007018.3-6093s1c1
Sequence:CCGGCCCAAACTAAACGGCAGCTTTCTCGAGAAAGCTGCCGTTTAGTTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007018.3-1856s1c1
Sequence:CCGGGCCCTGAAGAAGGATTTAGAACTCGAGTTCTAAATCCTTCTTCAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007018.3-622s1c1
Sequence:CCGGCCTCAATTTGAAAGGCAACAACTCGAGTTGTTGCCTTTCAAATTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007018.3-4630s1c1
Sequence:CCGGCCAATGTTTAAGCAAGAAGAACTCGAGTTCTTCTTGCTTAAACATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks