EMAIL THIS PAGE TO A FRIEND

CNTROB

centrobin, centrosomal BRCA2 interacting protein

64 Gene Product Result for
Synonyms: LIP8
Gene ID:
Human(116840) Summary: This gene encodes a centrosomal protein that interacts with BRCA2, and is required for centriole duplication and cytokinesis. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
Mouse(216846) centrobin, centrosomal BRCA2 interacting protein
Rat(303240) centrobin, centrosomal BRCA2 interacting protein
domestic cat(101100763) centrobin, centrosomal BRCA2 interacting protein
dog(489484) centrobin, centrosomal BRCA2 interacting protein
naked mole-rat(101706536) centrobin, centrosomal BRCA2 interacting protein
domestic guinea pig(100732549) centrobin, centrosomal BRCA2 interacting protein
sheep(101120679) centrobin, centrosomal BRCA2 interacting protein
Domestic Rabbit(100345619) centrobin, centrosomal BRCA2 interacting protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_053051 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_053051 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_053051 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172560 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172560 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172560 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001037144 Rosetta Predictions human pricing
NM_053051 Rosetta Predictions human pricing
NM_001134645 Rosetta Predictions rat pricing
NM_172560 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037144 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00139593 predicted 1744
2 SASI_Hs01_00139594 predicted 1259
3 SASI_Hs01_00139595 predicted 1003
4 SASI_Hs01_00139596 predicted 1185
5 SASI_Hs01_00139597 predicted 1113
6 SASI_Hs01_00139598 predicted 1364
7 SASI_Hs01_00139599 predicted 1202
8 SASI_Hs01_00139600 predicted 3078
9 SASI_Hs01_00139601 predicted 1512
10 SASI_Hs01_00139602 predicted 1475
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053051 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00134769 predicted 1676
2 SASI_Hs01_00134770 predicted 1191
3 SASI_Hs01_00134771 predicted 940
4 SASI_Hs01_00134772 predicted 1124
5 SASI_Hs01_00134773 predicted 1055
6 SASI_Hs01_00134774 predicted 1309
7 SASI_Hs01_00134775 predicted 1135
8 SASI_Hs01_00134776 predicted 3017
9 SASI_Hs01_00134777 predicted 1447
10 SASI_Hs01_00134778 predicted 1406
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134645 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00257909 predicted 501
2 SASI_Rn02_00257910 predicted 554
3 SASI_Rn02_00257911 predicted 558
4 SASI_Rn02_00257912 predicted 423
5 SASI_Rn02_00257913 predicted 326
6 SASI_Rn02_00257914 predicted 420
7 SASI_Rn02_00257915 predicted 796
8 SASI_Rn02_00257916 predicted 885
9 SASI_Rn02_00257917 predicted 1115
10 SASI_Rn02_00257918 predicted 2490
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172560 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00344190 predicted 1941
2 SASI_Mm02_00344191 predicted 1093
3 SASI_Mm02_00344192 predicted 1106
4 SASI_Mm01_00129913 predicted 3164
5 SASI_Mm01_00129915 predicted 2389
6 SASI_Mm02_00344193 predicted 3659
7 SASI_Mm02_00344194 predicted 1192
8 SASI_Mm02_00344195 predicted 1184
9 SASI_Mm02_00344196 predicted 1996
10 SASI_Mm02_00344197 predicted 3656
11 SASI_Mm01_00129906 predicted 2862
12 SASI_Mm01_00129907 predicted 2782
13 SASI_Mm01_00129908 predicted 3455
14 SASI_Mm01_00129909 predicted 1463
15 SASI_Mm01_00129910 predicted 3011
16 SASI_Mm01_00129911 predicted 3251
17 SASI_Mm01_00129912 predicted 2019
18 SASI_Mm01_00129914 predicted 1928
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053051
VALIDATED
CNTROB MISSION shRNA Bacterial Glycerol Stock
centrobin, centrosomal BRCA2 interacting protein
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000167826    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_053051.1-1127s1c1
Sequence:CCGGGATGGTTCTAAGCATATCTTTCTCGAGAAAGATATGCTTAGAACCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053051.1-3240s1c1
Sequence:CCGGGAGATGGGCTTACATTCCCAACTCGAGTTGGGAATGTAAGCCCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053051.1-1484s1c1
Sequence:CCGGCGAGTGTTAGAGCTACAGCAACTCGAGTTGCTGTAGCTCTAACACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_053051.1-1531s1c1
Sequence:CCGGCCGCAAGAAAGATACCATGATCTCGAGATCATGGTATCTTTCTTGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053051.1-1072s1c1
Sequence:CCGGCCAAGAATTGAGTCGAAGCTTCTCGAGAAGCTTCGACTCAATTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053051.2-1191s21c1
Sequence:CCGGATGGTTCTAAGCATATCTTTGCTCGAGCAAAGATATGCTTAGAACCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053051.2-3094s21c1
Sequence:CCGGGAACCCTTCTGTCGACCTGTTCTCGAGAACAGGTCGACAGAAGGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053051.2-1817s21c1
Sequence:CCGGAGACTGCAGCAACGGGAAAGACTCGAGTCTTTCCCGTTGCTGCAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053051.2-3340s21c1
Sequence:CCGGGTCTCAACTGTTGCGACTCTACTCGAGTAGAGTCGCAACAGTTGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053051.2-2443s21c1
Sequence:CCGGAGAACGAGAGGAACGGCAACACTCGAGTGTTGCCGTTCCTCTCGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053051.2-1750s21c1
Sequence:CCGGAGTAACCCGCCTGGAACAAAGCTCGAGCTTTGTTCCAGGCGGGTTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053051.2-1368s21c1
Sequence:CCGGTGCAAGACTTGTCTCCATCTACTCGAGTAGATGGAGACAAGTCTTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053051.2-2419s21c1
Sequence:CCGGAGCTCAGTTCAAGGTGGAAATCTCGAGATTTCCACCTTGAACTGAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053051.2-1942s21c1
Sequence:CCGGACTGAGTGAGCATCGAGAGTTCTCGAGAACTCTCGATGCTCACTCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053051
VALIDATED
CNTROB MISSION shRNA shRNA Plasmid DNA
centrobin, centrosomal BRCA2 interacting protein
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000167826    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_053051.1-1127s1c1
Sequence:CCGGGATGGTTCTAAGCATATCTTTCTCGAGAAAGATATGCTTAGAACCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053051.1-3240s1c1
Sequence:CCGGGAGATGGGCTTACATTCCCAACTCGAGTTGGGAATGTAAGCCCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053051.1-1484s1c1
Sequence:CCGGCGAGTGTTAGAGCTACAGCAACTCGAGTTGCTGTAGCTCTAACACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_053051.1-1531s1c1
Sequence:CCGGCCGCAAGAAAGATACCATGATCTCGAGATCATGGTATCTTTCTTGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053051.1-1072s1c1
Sequence:CCGGCCAAGAATTGAGTCGAAGCTTCTCGAGAAGCTTCGACTCAATTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053051.2-1191s21c1
Sequence:CCGGATGGTTCTAAGCATATCTTTGCTCGAGCAAAGATATGCTTAGAACCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053051.2-3094s21c1
Sequence:CCGGGAACCCTTCTGTCGACCTGTTCTCGAGAACAGGTCGACAGAAGGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053051.2-1817s21c1
Sequence:CCGGAGACTGCAGCAACGGGAAAGACTCGAGTCTTTCCCGTTGCTGCAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053051.2-3340s21c1
Sequence:CCGGGTCTCAACTGTTGCGACTCTACTCGAGTAGAGTCGCAACAGTTGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053051.2-2443s21c1
Sequence:CCGGAGAACGAGAGGAACGGCAACACTCGAGTGTTGCCGTTCCTCTCGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053051.2-1750s21c1
Sequence:CCGGAGTAACCCGCCTGGAACAAAGCTCGAGCTTTGTTCCAGGCGGGTTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053051.2-1368s21c1
Sequence:CCGGTGCAAGACTTGTCTCCATCTACTCGAGTAGATGGAGACAAGTCTTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053051.2-2419s21c1
Sequence:CCGGAGCTCAGTTCAAGGTGGAAATCTCGAGATTTCCACCTTGAACTGAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053051.2-1942s21c1
Sequence:CCGGACTGAGTGAGCATCGAGAGTTCTCGAGAACTCTCGATGCTCACTCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053051
VALIDATED
CNTROB MISSION shRNA Lentiviral Transduction Particles
centrobin, centrosomal BRCA2 interacting protein
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000167826    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_053051.1-1127s1c1
Sequence:CCGGGATGGTTCTAAGCATATCTTTCTCGAGAAAGATATGCTTAGAACCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053051.1-3240s1c1
Sequence:CCGGGAGATGGGCTTACATTCCCAACTCGAGTTGGGAATGTAAGCCCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053051.1-1484s1c1
Sequence:CCGGCGAGTGTTAGAGCTACAGCAACTCGAGTTGCTGTAGCTCTAACACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_053051.1-1531s1c1
Sequence:CCGGCCGCAAGAAAGATACCATGATCTCGAGATCATGGTATCTTTCTTGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053051.1-1072s1c1
Sequence:CCGGCCAAGAATTGAGTCGAAGCTTCTCGAGAAGCTTCGACTCAATTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053051.2-1191s21c1
Sequence:CCGGATGGTTCTAAGCATATCTTTGCTCGAGCAAAGATATGCTTAGAACCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053051.2-3094s21c1
Sequence:CCGGGAACCCTTCTGTCGACCTGTTCTCGAGAACAGGTCGACAGAAGGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053051.2-1817s21c1
Sequence:CCGGAGACTGCAGCAACGGGAAAGACTCGAGTCTTTCCCGTTGCTGCAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053051.2-3340s21c1
Sequence:CCGGGTCTCAACTGTTGCGACTCTACTCGAGTAGAGTCGCAACAGTTGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053051.2-2443s21c1
Sequence:CCGGAGAACGAGAGGAACGGCAACACTCGAGTGTTGCCGTTCCTCTCGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053051.2-1750s21c1
Sequence:CCGGAGTAACCCGCCTGGAACAAAGCTCGAGCTTTGTTCCAGGCGGGTTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053051.2-1368s21c1
Sequence:CCGGTGCAAGACTTGTCTCCATCTACTCGAGTAGATGGAGACAAGTCTTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053051.2-2419s21c1
Sequence:CCGGAGCTCAGTTCAAGGTGGAAATCTCGAGATTTCCACCTTGAACTGAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053051.2-1942s21c1
Sequence:CCGGACTGAGTGAGCATCGAGAGTTCTCGAGAACTCTCGATGCTCACTCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172560
VALIDATED
CNTROB MISSION shRNA Bacterial Glycerol Stock
centrobin, centrosomal BRCA2 interacting protein
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000195922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172560.1-3037s1c1
Sequence:CCGGCCTCAACCAATTTGCAAGGCACTCGAGTGCCTTGCAAATTGGTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172560.1-3232s1c1
Sequence:CCGGGAAGAAACACAGACTCCCGTTCTCGAGAACGGGAGTCTGTGTTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179954    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172560.1-3407s1c1
Sequence:CCGGCTCCTCTTCTGCCATTCATTTCTCGAGAAATGAATGGCAGAAGAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172560.1-2823s1c1
Sequence:CCGGCTTGAAGGCCTCAAGAACTTTCTCGAGAAAGTTCTTGAGGCCTTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172560
VALIDATED
CNTROB MISSION shRNA shRNA Plasmid DNA
centrobin, centrosomal BRCA2 interacting protein
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000195922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172560.1-3037s1c1
Sequence:CCGGCCTCAACCAATTTGCAAGGCACTCGAGTGCCTTGCAAATTGGTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172560.1-3232s1c1
Sequence:CCGGGAAGAAACACAGACTCCCGTTCTCGAGAACGGGAGTCTGTGTTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179954    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172560.1-3407s1c1
Sequence:CCGGCTCCTCTTCTGCCATTCATTTCTCGAGAAATGAATGGCAGAAGAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172560.1-2823s1c1
Sequence:CCGGCTTGAAGGCCTCAAGAACTTTCTCGAGAAAGTTCTTGAGGCCTTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172560
VALIDATED
CNTROB MISSION shRNA Lentiviral Transduction Particles
centrobin, centrosomal BRCA2 interacting protein
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000195922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172560.1-3037s1c1
Sequence:CCGGCCTCAACCAATTTGCAAGGCACTCGAGTGCCTTGCAAATTGGTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172560.1-3232s1c1
Sequence:CCGGGAAGAAACACAGACTCCCGTTCTCGAGAACGGGAGTCTGTGTTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179954    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172560.1-3407s1c1
Sequence:CCGGCTCCTCTTCTGCCATTCATTTCTCGAGAAATGAATGGCAGAAGAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172560.1-2823s1c1
Sequence:CCGGCTTGAAGGCCTCAAGAACTTTCTCGAGAAAGTTCTTGAGGCCTTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks