EMAIL THIS PAGE TO A FRIEND

COA1

cytochrome c oxidase assembly factor 1 homolog (S. cerevisiae)

26 Gene Product Result for
Synonyms: C7orf44 MITRAC15
UniProtKB ID: Q9GZY4, A6NJU8, A8KAH8, Q9HAB7, Q9NVD2
Gene ID:
dog(608597) cytochrome C oxidase assembly factor 1 homolog (S. cerevisiae)
cow(505736) cytochrome C oxidase assembly factor 1 homolog (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018224 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018224 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018224 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU082461 MISSION® esiRNA esiRNA human C7orf44 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018224 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018224 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00059466 predicted 469
2 SASI_Hs01_00059467 predicted 287
3 SASI_Hs01_00059469 predicted 209
4 SASI_Hs01_00059470 predicted 548
5 SASI_Hs02_00351536 predicted 523
6 SASI_Hs01_00059472 predicted 281
7 SASI_Hs01_00059474 predicted 545
8 SASI_Hs01_00059475 predicted 433
9 SASI_Hs02_00351537 predicted 461
10 SASI_Hs02_00351538 predicted 331
11 SASI_Hs01_00059468 predicted 620
12 SASI_Hs01_00059471 predicted 216
13 SASI_Hs01_00059473 predicted 622
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018224
COA1 MISSION shRNA Bacterial Glycerol Stock
cytochrome c oxidase assembly factor 1 homolog (S. cerevisiae)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018224.2-135s21c1
Sequence:CCGGCTCTGGGAGCAAGGATCCTTTCTCGAGAAAGGATCCTTGCTCCCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143935    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018224.1-310s1c1
Sequence:CCGGCCAGGGCTTTATATTACAAGTCTCGAGACTTGTAATATAAAGCCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018224.1-565s1c1
Sequence:CCGGGTCAGCAGATTCCTGTGTTCACTCGAGTGAACACAGGAATCTGCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140634    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018224.1-569s1c1
Sequence:CCGGGCAGATTCCTGTGTTCAAGCTCTCGAGAGCTTGAACACAGGAATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122690    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018224.1-1541s1c1
Sequence:CCGGGCCTGCTAACACAGTATCCATCTCGAGATGGATACTGTGTTAGCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018224.1-276s1c1
Sequence:CCGGGCCATTGTGTATTACCTCATTCTCGAGAATGAGGTAATACACAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144830    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018224.1-1203s1c1
Sequence:CCGGGCTGTATAAACGCAACAACAACTCGAGTTGTTGTTGCGTTTATACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018224.1-438s1c1
Sequence:CCGGGTTGATGCCAAGTTGAAGATTCTCGAGAATCTTCAACTTGGCATCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018224
COA1 MISSION shRNA shRNA Plasmid DNA
cytochrome c oxidase assembly factor 1 homolog (S. cerevisiae)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018224.2-135s21c1
Sequence:CCGGCTCTGGGAGCAAGGATCCTTTCTCGAGAAAGGATCCTTGCTCCCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143935    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018224.1-310s1c1
Sequence:CCGGCCAGGGCTTTATATTACAAGTCTCGAGACTTGTAATATAAAGCCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018224.1-565s1c1
Sequence:CCGGGTCAGCAGATTCCTGTGTTCACTCGAGTGAACACAGGAATCTGCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140634    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018224.1-569s1c1
Sequence:CCGGGCAGATTCCTGTGTTCAAGCTCTCGAGAGCTTGAACACAGGAATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122690    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018224.1-1541s1c1
Sequence:CCGGGCCTGCTAACACAGTATCCATCTCGAGATGGATACTGTGTTAGCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018224.1-276s1c1
Sequence:CCGGGCCATTGTGTATTACCTCATTCTCGAGAATGAGGTAATACACAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144830    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018224.1-1203s1c1
Sequence:CCGGGCTGTATAAACGCAACAACAACTCGAGTTGTTGTTGCGTTTATACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018224.1-438s1c1
Sequence:CCGGGTTGATGCCAAGTTGAAGATTCTCGAGAATCTTCAACTTGGCATCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018224
COA1 MISSION shRNA Lentiviral Transduction Particles
cytochrome c oxidase assembly factor 1 homolog (S. cerevisiae)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018224.2-135s21c1
Sequence:CCGGCTCTGGGAGCAAGGATCCTTTCTCGAGAAAGGATCCTTGCTCCCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143935    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018224.1-310s1c1
Sequence:CCGGCCAGGGCTTTATATTACAAGTCTCGAGACTTGTAATATAAAGCCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018224.1-565s1c1
Sequence:CCGGGTCAGCAGATTCCTGTGTTCACTCGAGTGAACACAGGAATCTGCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140634    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018224.1-569s1c1
Sequence:CCGGGCAGATTCCTGTGTTCAAGCTCTCGAGAGCTTGAACACAGGAATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122690    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018224.1-1541s1c1
Sequence:CCGGGCCTGCTAACACAGTATCCATCTCGAGATGGATACTGTGTTAGCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018224.1-276s1c1
Sequence:CCGGGCCATTGTGTATTACCTCATTCTCGAGAATGAGGTAATACACAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144830    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018224.1-1203s1c1
Sequence:CCGGGCTGTATAAACGCAACAACAACTCGAGTTGTTGTTGCGTTTATACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018224.1-438s1c1
Sequence:CCGGGTTGATGCCAAGTTGAAGATTCTCGAGAATCTTCAACTTGGCATCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks