EMAIL THIS PAGE TO A FRIEND

COA3

cytochrome c oxidase assembly factor 3

Synonyms: CCDC56 MITRAC12
UniProtKB ID: Q9Y2R0, A8K498
Gene ID:
Human(28958) Summary: This gene encodes a member of the cytochrome c oxidase assembly factor family. Studies of a related gene in fly suggest that the encoded protein is localized to mitochondria and is essential for cytochrome c oxidase function. [provided by RefSeq, Nov 2012]
Mouse(52469) cytochrome C oxidase assembly factor 3
Rat(498000) cytochrome C oxidase assembly factor 3
Zebrafish(100141351) cytochrome C oxidase assembly factor 3
cow(539832) coiled-coil domain containing 56
39 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA031966 Anti-COA3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026618 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026618 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026618 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014019 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014019 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014019 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001040431 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001040431 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001040431 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001040431 Rosetta Predictions human pricing
NM_001109047 Rosetta Predictions rat pricing
NM_026618 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040431 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00233034 predicted 471
2 SASI_Hs01_00233035 predicted 468
3 SASI_Hs01_00233036 predicted 328
4 SASI_Hs01_00233037 predicted 206
5 SASI_Hs02_00308958 predicted 521
6 SASI_Hs01_00233038 predicted 406
7 SASI_Hs01_00233039 predicted 412
8 SASI_Hs01_00233040 predicted 457
9 SASI_Hs01_00233041 predicted 455
10 SASI_Hs01_00233043 predicted 404
11 SASI_Hs01_00233042 predicted 227
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109047 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00244604 predicted 422
2 SASI_Rn02_00244605 predicted 260
3 SASI_Rn02_00244606 predicted 422
4 SASI_Rn02_00244607 predicted 424
5 SASI_Rn02_00244608 predicted 248
6 SASI_Rn02_00244609 predicted 345
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026618 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00132369 predicted 223
2 SASI_Mm01_00132370 predicted 418
3 SASI_Mm01_00132371 predicted 346
4 SASI_Mm01_00132372 predicted 338
5 SASI_Mm01_00132373 predicted 412
6 SASI_Mm01_00132374 predicted 215
7 SASI_Mm01_00132375 predicted 406
8 SASI_Mm01_00132376 predicted 338
9 SASI_Mm01_00132377 predicted 258
10 SASI_Mm02_00330581 predicted 236
11 SASI_Mm01_00132378 predicted 452
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026618
VALIDATED
COA3 MISSION shRNA Bacterial Glycerol Stock
cytochrome c oxidase assembly factor 3
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000126029    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026618.1-570s1c1
Sequence:CCGGCCTTGCCTTTACCCAAACTTTCTCGAGAAAGTTTGGGTAAAGGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026618.1-219s1c1
Sequence:CCGGGCCCTGGTGTTAGCTATTTATCTCGAGATAAATAGCTAACACCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026618.1-58s1c1
Sequence:CCGGCTAAGAATGGAAATGCTCCATCTCGAGATGGAGCATTTCCATTCTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026618.1-51s1c1
Sequence:CCGGCTGAATGCTAAGAATGGAAATCTCGAGATTTCCATTCTTAGCATTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026618.1-116s1c1
Sequence:CCGGCCCAGCGCAGTTGCAGTTTATCTCGAGATAAACTGCAACTGCGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325739    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026618.2-568s21c1
Sequence:CCGGCCTTGCCTTTACCCAAACTTTCTCGAGAAAGTTTGGGTAAAGGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026618.2-49s21c1
Sequence:CCGGCTGAATGCTAAGAATGGAAATCTCGAGATTTCCATTCTTAGCATTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026618.2-217s21c1
Sequence:CCGGGCCCTGGTGTTAGCTATTTATCTCGAGATAAATAGCTAACACCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026618.2-114s21c1
Sequence:CCGGCCCAGCGCAGTTGCAGTTTATCTCGAGATAAACTGCAACTGCGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026618
VALIDATED
COA3 MISSION shRNA shRNA Plasmid DNA
cytochrome c oxidase assembly factor 3
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000126029    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026618.1-570s1c1
Sequence:CCGGCCTTGCCTTTACCCAAACTTTCTCGAGAAAGTTTGGGTAAAGGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026618.1-219s1c1
Sequence:CCGGGCCCTGGTGTTAGCTATTTATCTCGAGATAAATAGCTAACACCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026618.1-58s1c1
Sequence:CCGGCTAAGAATGGAAATGCTCCATCTCGAGATGGAGCATTTCCATTCTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026618.1-51s1c1
Sequence:CCGGCTGAATGCTAAGAATGGAAATCTCGAGATTTCCATTCTTAGCATTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026618.1-116s1c1
Sequence:CCGGCCCAGCGCAGTTGCAGTTTATCTCGAGATAAACTGCAACTGCGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325739    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026618.2-568s21c1
Sequence:CCGGCCTTGCCTTTACCCAAACTTTCTCGAGAAAGTTTGGGTAAAGGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026618.2-49s21c1
Sequence:CCGGCTGAATGCTAAGAATGGAAATCTCGAGATTTCCATTCTTAGCATTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026618.2-217s21c1
Sequence:CCGGGCCCTGGTGTTAGCTATTTATCTCGAGATAAATAGCTAACACCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026618.2-114s21c1
Sequence:CCGGCCCAGCGCAGTTGCAGTTTATCTCGAGATAAACTGCAACTGCGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026618
VALIDATED
COA3 MISSION shRNA Lentiviral Transduction Particles
cytochrome c oxidase assembly factor 3
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000126029    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026618.1-570s1c1
Sequence:CCGGCCTTGCCTTTACCCAAACTTTCTCGAGAAAGTTTGGGTAAAGGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026618.1-219s1c1
Sequence:CCGGGCCCTGGTGTTAGCTATTTATCTCGAGATAAATAGCTAACACCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026618.1-58s1c1
Sequence:CCGGCTAAGAATGGAAATGCTCCATCTCGAGATGGAGCATTTCCATTCTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026618.1-51s1c1
Sequence:CCGGCTGAATGCTAAGAATGGAAATCTCGAGATTTCCATTCTTAGCATTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026618.1-116s1c1
Sequence:CCGGCCCAGCGCAGTTGCAGTTTATCTCGAGATAAACTGCAACTGCGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325739    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026618.2-568s21c1
Sequence:CCGGCCTTGCCTTTACCCAAACTTTCTCGAGAAAGTTTGGGTAAAGGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026618.2-49s21c1
Sequence:CCGGCTGAATGCTAAGAATGGAAATCTCGAGATTTCCATTCTTAGCATTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026618.2-217s21c1
Sequence:CCGGGCCCTGGTGTTAGCTATTTATCTCGAGATAAATAGCTAACACCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026618.2-114s21c1
Sequence:CCGGCCCAGCGCAGTTGCAGTTTATCTCGAGATAAACTGCAACTGCGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014019
COA3 MISSION shRNA Bacterial Glycerol Stock
cytochrome c oxidase assembly factor 3
Human
1 Products Total
TRC Number Price Set Price (1)? Select
TRCN0000180725    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014019.1-215s1c1
Sequence:CCGGGCCCTGGTGTTGGCTATTTATCTCGAGATAAATAGCCAACACCAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014019
COA3 MISSION shRNA shRNA Plasmid DNA
cytochrome c oxidase assembly factor 3
Human
1 Products Total
TRC Number Vector Price Set Price (1)? Select
TRCN0000180725    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014019.1-215s1c1
Sequence:CCGGGCCCTGGTGTTGGCTATTTATCTCGAGATAAATAGCCAACACCAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014019
COA3 MISSION shRNA Lentiviral Transduction Particles
cytochrome c oxidase assembly factor 3
Human
1 Products Total
TRC Number Volume Titer Vector Price Set Price (1)? Select
TRCN0000180725    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014019.1-215s1c1
Sequence:CCGGGCCCTGGTGTTGGCTATTTATCTCGAGATAAATAGCCAACACCAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001040431
COA3 MISSION shRNA Bacterial Glycerol Stock
cytochrome c oxidase assembly factor 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000244193    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001040431.1-437s21c1
Sequence:CCGGACTAACCTTGGACCGTGATTGCTCGAGCAATCACGGTCCAAGGTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040431.1-94s21c1
Sequence:CCGGTGACACCCGAGCAACTGCATTCTCGAGAATGCAGTTGCTCGGGTGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040431.1-202s21c1
Sequence:CCGGCCCTGGTGTTGGCTATTTATGCTCGAGCATAAATAGCCAACACCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040431.1-224s21c1
Sequence:CCGGTTACACCTTCTACTCGATTTCCTCGAGGAAATCGAGTAGAAGGTGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040431.1-321s21c1
Sequence:CCGGTCCTAATCTGGATGGGTATTGCTCGAGCAATACCCATCCAGATTAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001040431
COA3 MISSION shRNA shRNA Plasmid DNA
cytochrome c oxidase assembly factor 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000244193    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001040431.1-437s21c1
Sequence:CCGGACTAACCTTGGACCGTGATTGCTCGAGCAATCACGGTCCAAGGTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040431.1-94s21c1
Sequence:CCGGTGACACCCGAGCAACTGCATTCTCGAGAATGCAGTTGCTCGGGTGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040431.1-202s21c1
Sequence:CCGGCCCTGGTGTTGGCTATTTATGCTCGAGCATAAATAGCCAACACCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040431.1-224s21c1
Sequence:CCGGTTACACCTTCTACTCGATTTCCTCGAGGAAATCGAGTAGAAGGTGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040431.1-321s21c1
Sequence:CCGGTCCTAATCTGGATGGGTATTGCTCGAGCAATACCCATCCAGATTAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001040431
COA3 MISSION shRNA Lentiviral Transduction Particles
cytochrome c oxidase assembly factor 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000244193    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001040431.1-437s21c1
Sequence:CCGGACTAACCTTGGACCGTGATTGCTCGAGCAATCACGGTCCAAGGTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040431.1-94s21c1
Sequence:CCGGTGACACCCGAGCAACTGCATTCTCGAGAATGCAGTTGCTCGGGTGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040431.1-202s21c1
Sequence:CCGGCCCTGGTGTTGGCTATTTATGCTCGAGCATAAATAGCCAACACCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040431.1-224s21c1
Sequence:CCGGTTACACCTTCTACTCGATTTCCTCGAGGAAATCGAGTAGAAGGTGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040431.1-321s21c1
Sequence:CCGGTCCTAATCTGGATGGGTATTGCTCGAGCAATACCCATCCAGATTAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks