EMAIL THIS PAGE TO A FRIEND

COA4

cytochrome c oxidase assembly factor 4 homolog (S. cerevisiae)

62 Gene Product Result for
Synonyms: CHCHD8 CMC3 E2IG2
UniProtKB ID: Q9NYJ1, B2RAA0, Q69YU4
Gene ID:
Mouse(68185) cytochrome c oxidase assembly factor 4
Rat(499214) cytochrome c oxidase assembly factor 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_183270 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_183270 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_183270 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016565 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016565 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016565 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU103371 MISSION® esiRNA esiRNA human CHCHD8 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016565 Rosetta Predictions human pricing
NM_001127655 Rosetta Predictions rat pricing
NM_183270 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016565 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00115979 predicted 277
2 SASI_Hs01_00115980 predicted 276
3 SASI_Hs01_00115982 predicted 411
4 SASI_Hs01_00115983 predicted 406
5 SASI_Hs01_00115984 predicted 443
6 SASI_Hs02_00349697 predicted 432
7 SASI_Hs01_00115986 predicted 395
8 SASI_Hs01_00115987 predicted 265
9 SASI_Hs01_00115988 predicted 211
10 SASI_Hs02_00349698 predicted 268
11 SASI_Hs01_00115981 predicted 420
12 SASI_Hs01_00115985 predicted 350
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127655 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00254790 predicted 258
2 SASI_Rn02_00254791 predicted 329
3 SASI_Rn02_00254792 predicted 664
4 SASI_Rn02_00254793 predicted 473
5 SASI_Rn02_00254794 predicted 354
6 SASI_Rn02_00254795 predicted 558
7 SASI_Rn02_00254796 predicted 619
8 SASI_Rn02_00254797 predicted 611
9 SASI_Rn02_00254798 predicted 568
10 SASI_Rn02_00254799 predicted 781
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183270 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00350359 predicted 360
2 SASI_Mm02_00350360 predicted 492
3 SASI_Mm02_00350361 predicted 205
4 SASI_Mm01_00118068 predicted 417
5 SASI_Mm02_00350362 predicted 376
6 SASI_Mm02_00350363 predicted 374
7 SASI_Mm02_00350364 predicted 479
8 SASI_Mm01_00118070 predicted 525
9 SASI_Mm02_00350365 predicted 346
10 SASI_Mm02_00350366 predicted 462
11 SASI_Mm01_00118065 predicted 802
12 SASI_Mm01_00118066 predicted 408
13 SASI_Mm01_00118067 predicted 502
14 SASI_Mm01_00118069 predicted 603
15 SASI_Mm01_00118071 predicted 467
16 SASI_Mm01_00118072 predicted 830
17 SASI_Mm01_00118073 predicted 761
18 SASI_Mm01_00118074 predicted 683
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183270
COA4 MISSION shRNA Bacterial Glycerol Stock
cytochrome c oxidase assembly factor 4 homolog (S. cerevisiae)
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000217931    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_183270.2-623s1c1
Sequence:CCGGGACTGTGTGCCAAGTACTTTACTCGAGTAAAGTACTTGGCACACAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216048    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_183270.2-552s1c1
Sequence:CCGGCATATCCTCCACATTCTTGTTCTCGAGAACAAGAATGTGGAGGATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215939    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_183270.2-563s1c1
Sequence:CCGGCATTCTTGTTCTACCAATATTCTCGAGAATATTGGTAGAACAAGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183270.1-115s1c1
Sequence:CCGGCCGGTGAAGAAGGATGATGATCTCGAGATCATCATCCTTCTTCACCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183270.1-123s1c1
Sequence:CCGGGAAGGATGATGATGAGGAAGACTCGAGTCTTCCTCATCATCATCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181523    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183270.1-120s1c1
Sequence:CCGGGAAGAAGGATGATGATGAGGACTCGAGTCCTCATCATCATCCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182770    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183270.1-392s1c1
Sequence:CCGGCCTGGGAAGAAGAAACCCTAACTCGAGTTAGGGTTTCTTCTTCCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183270.1-253s1c1
Sequence:CCGGGCCTTCAGGGATTGTATGAGTCTCGAGACTCATACAATCCCTGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182565    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183270.1-800s1c1
Sequence:CCGGGCAGTGACATAAGTGCCTCTACTCGAGTAGAGGCACTTATGTCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200074    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_183270.1-1043s1c1
Sequence:CCGGCCCTCACCAAACCAACACAAACTCGAGTTTGTGTTGGTTTGGTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198657    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_183270.1-907s1c1
Sequence:CCGGCCCAGACTGATCTTAGACTTACTCGAGTAAGTCTAAGATCAGTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183270
COA4 MISSION shRNA shRNA Plasmid DNA
cytochrome c oxidase assembly factor 4 homolog (S. cerevisiae)
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000217931    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_183270.2-623s1c1
Sequence:CCGGGACTGTGTGCCAAGTACTTTACTCGAGTAAAGTACTTGGCACACAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216048    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_183270.2-552s1c1
Sequence:CCGGCATATCCTCCACATTCTTGTTCTCGAGAACAAGAATGTGGAGGATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215939    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_183270.2-563s1c1
Sequence:CCGGCATTCTTGTTCTACCAATATTCTCGAGAATATTGGTAGAACAAGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183270.1-115s1c1
Sequence:CCGGCCGGTGAAGAAGGATGATGATCTCGAGATCATCATCCTTCTTCACCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183270.1-123s1c1
Sequence:CCGGGAAGGATGATGATGAGGAAGACTCGAGTCTTCCTCATCATCATCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181523    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183270.1-120s1c1
Sequence:CCGGGAAGAAGGATGATGATGAGGACTCGAGTCCTCATCATCATCCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182770    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183270.1-392s1c1
Sequence:CCGGCCTGGGAAGAAGAAACCCTAACTCGAGTTAGGGTTTCTTCTTCCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183270.1-253s1c1
Sequence:CCGGGCCTTCAGGGATTGTATGAGTCTCGAGACTCATACAATCCCTGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182565    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183270.1-800s1c1
Sequence:CCGGGCAGTGACATAAGTGCCTCTACTCGAGTAGAGGCACTTATGTCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200074    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_183270.1-1043s1c1
Sequence:CCGGCCCTCACCAAACCAACACAAACTCGAGTTTGTGTTGGTTTGGTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198657    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_183270.1-907s1c1
Sequence:CCGGCCCAGACTGATCTTAGACTTACTCGAGTAAGTCTAAGATCAGTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183270
COA4 MISSION shRNA Lentiviral Transduction Particles
cytochrome c oxidase assembly factor 4 homolog (S. cerevisiae)
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000217931    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_183270.2-623s1c1
Sequence:CCGGGACTGTGTGCCAAGTACTTTACTCGAGTAAAGTACTTGGCACACAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216048    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_183270.2-552s1c1
Sequence:CCGGCATATCCTCCACATTCTTGTTCTCGAGAACAAGAATGTGGAGGATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215939    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_183270.2-563s1c1
Sequence:CCGGCATTCTTGTTCTACCAATATTCTCGAGAATATTGGTAGAACAAGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183270.1-115s1c1
Sequence:CCGGCCGGTGAAGAAGGATGATGATCTCGAGATCATCATCCTTCTTCACCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183270.1-123s1c1
Sequence:CCGGGAAGGATGATGATGAGGAAGACTCGAGTCTTCCTCATCATCATCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181523    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183270.1-120s1c1
Sequence:CCGGGAAGAAGGATGATGATGAGGACTCGAGTCCTCATCATCATCCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182770    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183270.1-392s1c1
Sequence:CCGGCCTGGGAAGAAGAAACCCTAACTCGAGTTAGGGTTTCTTCTTCCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183270.1-253s1c1
Sequence:CCGGGCCTTCAGGGATTGTATGAGTCTCGAGACTCATACAATCCCTGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182565    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183270.1-800s1c1
Sequence:CCGGGCAGTGACATAAGTGCCTCTACTCGAGTAGAGGCACTTATGTCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200074    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_183270.1-1043s1c1
Sequence:CCGGCCCTCACCAAACCAACACAAACTCGAGTTTGTGTTGGTTTGGTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198657    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_183270.1-907s1c1
Sequence:CCGGCCCAGACTGATCTTAGACTTACTCGAGTAAGTCTAAGATCAGTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016565
VALIDATED
COA4 MISSION shRNA Bacterial Glycerol Stock
cytochrome c oxidase assembly factor 4 homolog (S. cerevisiae)
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000142566    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016565.2-292s1c1
Sequence:CCGGGATTGCATGAGTGAACAGCAGCTCGAGCTGCTGTTCACTCATGCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142187    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_016565.2-572s1c1
Sequence:CCGGGCTGTCTTGTTCCACCAGTATCTCGAGATACTGGTGGAACAAGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141872    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_016565.2-510s1c1
Sequence:CCGGGTTTGGACATGACTGGCACAACTCGAGTTGTGCCAGTCATGTCCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_016565.2-279s1c1
Sequence:CCGGGCAGGCGTTCAAGGATTGCATCTCGAGATGCAATCCTTGAACGCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016565.2-142s1c1
Sequence:CCGGCAACGGGTGAAGAAAGACGATCTCGAGATCGTCTTTCTTCACCCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_016565.2-283s1c1
Sequence:CCGGGCGTTCAAGGATTGCATGAGTCTCGAGACTCATGCAATCCTTGAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016565
VALIDATED
COA4 MISSION shRNA shRNA Plasmid DNA
cytochrome c oxidase assembly factor 4 homolog (S. cerevisiae)
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000142566    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016565.2-292s1c1
Sequence:CCGGGATTGCATGAGTGAACAGCAGCTCGAGCTGCTGTTCACTCATGCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142187    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_016565.2-572s1c1
Sequence:CCGGGCTGTCTTGTTCCACCAGTATCTCGAGATACTGGTGGAACAAGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141872    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_016565.2-510s1c1
Sequence:CCGGGTTTGGACATGACTGGCACAACTCGAGTTGTGCCAGTCATGTCCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_016565.2-279s1c1
Sequence:CCGGGCAGGCGTTCAAGGATTGCATCTCGAGATGCAATCCTTGAACGCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016565.2-142s1c1
Sequence:CCGGCAACGGGTGAAGAAAGACGATCTCGAGATCGTCTTTCTTCACCCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_016565.2-283s1c1
Sequence:CCGGGCGTTCAAGGATTGCATGAGTCTCGAGACTCATGCAATCCTTGAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016565
VALIDATED
COA4 MISSION shRNA Lentiviral Transduction Particles
cytochrome c oxidase assembly factor 4 homolog (S. cerevisiae)
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000142566    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016565.2-292s1c1
Sequence:CCGGGATTGCATGAGTGAACAGCAGCTCGAGCTGCTGTTCACTCATGCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142187    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_016565.2-572s1c1
Sequence:CCGGGCTGTCTTGTTCCACCAGTATCTCGAGATACTGGTGGAACAAGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141872    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_016565.2-510s1c1
Sequence:CCGGGTTTGGACATGACTGGCACAACTCGAGTTGTGCCAGTCATGTCCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_016565.2-279s1c1
Sequence:CCGGGCAGGCGTTCAAGGATTGCATCTCGAGATGCAATCCTTGAACGCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016565.2-142s1c1
Sequence:CCGGCAACGGGTGAAGAAAGACGATCTCGAGATCGTCTTTCTTCACCCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_016565.2-283s1c1
Sequence:CCGGGCGTTCAAGGATTGCATGAGTCTCGAGACTCATGCAATCCTTGAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks