EMAIL THIS PAGE TO A FRIEND

COA6

cytochrome c oxidase assembly factor 6 homolog (S. cerevisiae)

43 Gene Product Result for
Synonyms: C1orf31
UniProtKB ID: Q5JTJ3, Q5JTJ2, Q5JTJ4, Q8TA88
Gene ID:
Mouse(67892) cytochrome c oxidase assembly factor 6
cow(768072) cytochrome c oxidase assembly factor 6 homolog (S. cerevisiae)
dog(607627) cytochrome c oxidase assembly factor 6 homolog (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001012985 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001012985 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001012985 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_174987 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_174987 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_174987 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001012985 Rosetta Predictions human pricing
NM_174987 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012985 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00056415 predicted 407
2 SASI_Hs01_00056416 predicted 250
3 SASI_Hs01_00056417 predicted 225
4 SASI_Hs02_00306296 predicted 276
5 SASI_Hs01_00056418 predicted 407
6 SASI_Hs01_00056419 predicted 382
7 SASI_Hs01_00056420 predicted 221
8 SASI_Hs01_00056421 predicted 410
9 SASI_Hs01_00056422 predicted 220
10 SASI_Hs01_00056424 predicted 253
11 SASI_Hs01_00056423 predicted 218
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_174987 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00201627 predicted 418
2 SASI_Mm01_00201628 predicted 507
3 SASI_Mm01_00201629 predicted 476
4 SASI_Mm01_00201630 predicted 360
5 SASI_Mm01_00201632 predicted 493
6 SASI_Mm02_00345524 predicted 469
7 SASI_Mm01_00201633 predicted 467
8 SASI_Mm01_00201634 predicted 507
9 SASI_Mm01_00201636 predicted 388
10 SASI_Mm02_00345525 predicted 399
11 SASI_Mm01_00201631 predicted 511
12 SASI_Mm01_00201635 predicted 505
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001012985
COA6 MISSION shRNA Bacterial Glycerol Stock
cytochrome c oxidase assembly factor 6 homolog (S. cerevisiae)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000439622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012985.1-138s21c1
Sequence:CCGGACCTGTTTCTACAGCGCTTAGCTCGAGCTAAGCGCTGTAGAAACAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012985.1-414s21c1
Sequence:CCGGGGCTGTTCATAAAGATTGAAACTCGAGTTTCAATCTTTATGAACAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012985.1-284s21c1
Sequence:CCGGGAAGCTCTTTCGAATCAAGTTCTCGAGAACTTGATTCGAAAGAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426239    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001012985.1-469s21c1
Sequence:CCGGCTATGGAACAGTAATAGTTTGCTCGAGCAAACTATTACTGTTCCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012985.1-226s1c1
Sequence:CCGGGAGTACTGGAAGTGTTTAGATCTCGAGATCTAAACACTTCCAGTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012985.1-387s1c1
Sequence:CCGGGCCTTCAGAAACAACTGCAAACTCGAGTTTGCAGTTGTTTCTGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012985.1-223s1c1
Sequence:CCGGGATGAGTACTGGAAGTGTTTACTCGAGTAAACACTTCCAGTACTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147366    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012985.1-272s1c1
Sequence:CCGGGCAAGAAGTTAAGAAGCTCTTCTCGAGAAGAGCTTCTTAACTTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012985.1-231s1c1
Sequence:CCGGCTGGAAGTGTTTAGATGAGAACTCGAGTTCTCATCTAAACACTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012985.1-262s1c1
Sequence:CCGGGCTTCTCAATGCAAGAAGTTACTCGAGTAACTTCTTGCATTGAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001012985
COA6 MISSION shRNA shRNA Plasmid DNA
cytochrome c oxidase assembly factor 6 homolog (S. cerevisiae)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000439622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012985.1-138s21c1
Sequence:CCGGACCTGTTTCTACAGCGCTTAGCTCGAGCTAAGCGCTGTAGAAACAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012985.1-414s21c1
Sequence:CCGGGGCTGTTCATAAAGATTGAAACTCGAGTTTCAATCTTTATGAACAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012985.1-284s21c1
Sequence:CCGGGAAGCTCTTTCGAATCAAGTTCTCGAGAACTTGATTCGAAAGAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426239    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001012985.1-469s21c1
Sequence:CCGGCTATGGAACAGTAATAGTTTGCTCGAGCAAACTATTACTGTTCCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012985.1-226s1c1
Sequence:CCGGGAGTACTGGAAGTGTTTAGATCTCGAGATCTAAACACTTCCAGTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012985.1-387s1c1
Sequence:CCGGGCCTTCAGAAACAACTGCAAACTCGAGTTTGCAGTTGTTTCTGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012985.1-223s1c1
Sequence:CCGGGATGAGTACTGGAAGTGTTTACTCGAGTAAACACTTCCAGTACTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147366    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012985.1-272s1c1
Sequence:CCGGGCAAGAAGTTAAGAAGCTCTTCTCGAGAAGAGCTTCTTAACTTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012985.1-231s1c1
Sequence:CCGGCTGGAAGTGTTTAGATGAGAACTCGAGTTCTCATCTAAACACTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012985.1-262s1c1
Sequence:CCGGGCTTCTCAATGCAAGAAGTTACTCGAGTAACTTCTTGCATTGAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001012985
COA6 MISSION shRNA Lentiviral Transduction Particles
cytochrome c oxidase assembly factor 6 homolog (S. cerevisiae)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000439622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012985.1-138s21c1
Sequence:CCGGACCTGTTTCTACAGCGCTTAGCTCGAGCTAAGCGCTGTAGAAACAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012985.1-414s21c1
Sequence:CCGGGGCTGTTCATAAAGATTGAAACTCGAGTTTCAATCTTTATGAACAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012985.1-284s21c1
Sequence:CCGGGAAGCTCTTTCGAATCAAGTTCTCGAGAACTTGATTCGAAAGAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426239    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001012985.1-469s21c1
Sequence:CCGGCTATGGAACAGTAATAGTTTGCTCGAGCAAACTATTACTGTTCCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012985.1-226s1c1
Sequence:CCGGGAGTACTGGAAGTGTTTAGATCTCGAGATCTAAACACTTCCAGTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012985.1-387s1c1
Sequence:CCGGGCCTTCAGAAACAACTGCAAACTCGAGTTTGCAGTTGTTTCTGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012985.1-223s1c1
Sequence:CCGGGATGAGTACTGGAAGTGTTTACTCGAGTAAACACTTCCAGTACTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147366    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012985.1-272s1c1
Sequence:CCGGGCAAGAAGTTAAGAAGCTCTTCTCGAGAAGAGCTTCTTAACTTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012985.1-231s1c1
Sequence:CCGGCTGGAAGTGTTTAGATGAGAACTCGAGTTCTCATCTAAACACTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012985.1-262s1c1
Sequence:CCGGGCTTCTCAATGCAAGAAGTTACTCGAGTAACTTCTTGCATTGAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_174987
VALIDATED
COA6 MISSION shRNA Bacterial Glycerol Stock
cytochrome c oxidase assembly factor 6 homolog (S. cerevisiae)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000264885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174987.3-259s21c1
Sequence:CCGGCAGAAGCTGAGGAGCTCGTTCCTCGAGGAACGAGCTCCTCAGCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174987.3-396s21c1
Sequence:CCGGCTAGGCTCTTTCTGGACTTTCCTCGAGGAAAGTCCAGAAAGAGCCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264886    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_174987.3-505s21c1
Sequence:CCGGCTGTAAACAAGAGTTACTAAACTCGAGTTTAGTAACTCTTGTTTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174987.3-358s21c1
Sequence:CCGGGCAGGAGGATTCCAGTCTTCACTCGAGTGAAGACTGGAATCCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_174987.3-371s21c1
Sequence:CCGGAGTCTTCACAGTCGACTGAAACTCGAGTTTCAGTCGACTGTGAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200846    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_174987.2-495s1c1
Sequence:CCGGGCACTTGTTCTCTGTAAACAACTCGAGTTGTTTACAGAGAACAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191352    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_174987.2-448s1c1
Sequence:CCGGCAGAAATGATTCCAGGACAAACTCGAGTTTGTCCTGGAATCATTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190632    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_174987.2-447s1c1
Sequence:CCGGGCAGAAATGATTCCAGGACAACTCGAGTTGTCCTGGAATCATTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_174987
VALIDATED
COA6 MISSION shRNA shRNA Plasmid DNA
cytochrome c oxidase assembly factor 6 homolog (S. cerevisiae)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000264885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174987.3-259s21c1
Sequence:CCGGCAGAAGCTGAGGAGCTCGTTCCTCGAGGAACGAGCTCCTCAGCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174987.3-396s21c1
Sequence:CCGGCTAGGCTCTTTCTGGACTTTCCTCGAGGAAAGTCCAGAAAGAGCCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264886    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_174987.3-505s21c1
Sequence:CCGGCTGTAAACAAGAGTTACTAAACTCGAGTTTAGTAACTCTTGTTTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174987.3-358s21c1
Sequence:CCGGGCAGGAGGATTCCAGTCTTCACTCGAGTGAAGACTGGAATCCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_174987.3-371s21c1
Sequence:CCGGAGTCTTCACAGTCGACTGAAACTCGAGTTTCAGTCGACTGTGAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200846    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_174987.2-495s1c1
Sequence:CCGGGCACTTGTTCTCTGTAAACAACTCGAGTTGTTTACAGAGAACAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191352    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_174987.2-448s1c1
Sequence:CCGGCAGAAATGATTCCAGGACAAACTCGAGTTTGTCCTGGAATCATTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190632    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_174987.2-447s1c1
Sequence:CCGGGCAGAAATGATTCCAGGACAACTCGAGTTGTCCTGGAATCATTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_174987
VALIDATED
COA6 MISSION shRNA Lentiviral Transduction Particles
cytochrome c oxidase assembly factor 6 homolog (S. cerevisiae)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000264885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174987.3-259s21c1
Sequence:CCGGCAGAAGCTGAGGAGCTCGTTCCTCGAGGAACGAGCTCCTCAGCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174987.3-396s21c1
Sequence:CCGGCTAGGCTCTTTCTGGACTTTCCTCGAGGAAAGTCCAGAAAGAGCCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264886    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_174987.3-505s21c1
Sequence:CCGGCTGTAAACAAGAGTTACTAAACTCGAGTTTAGTAACTCTTGTTTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174987.3-358s21c1
Sequence:CCGGGCAGGAGGATTCCAGTCTTCACTCGAGTGAAGACTGGAATCCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_174987.3-371s21c1
Sequence:CCGGAGTCTTCACAGTCGACTGAAACTCGAGTTTCAGTCGACTGTGAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200846    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_174987.2-495s1c1
Sequence:CCGGGCACTTGTTCTCTGTAAACAACTCGAGTTGTTTACAGAGAACAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191352    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_174987.2-448s1c1
Sequence:CCGGCAGAAATGATTCCAGGACAAACTCGAGTTTGTCCTGGAATCATTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190632    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_174987.2-447s1c1
Sequence:CCGGGCAGAAATGATTCCAGGACAACTCGAGTTGTCCTGGAATCATTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks