EMAIL THIS PAGE TO A FRIEND

COASY

CoA synthase

107 Gene Product Result for
Synonyms: DPCK NBP PPAT UKR1 pOV-2
Gene ID:
Human(80347) Summary: Biosynthesis of coenzyme A (CoA) from pantothenic acid (vitamin B5) is an essential universal pathway in prokaryotes and eukaryotes. COASY is a bifunctional enzyme that catalyzes the 2 last steps in CoA synthesis. These activities are performed by 2 separate enzymes, phosphopantetheine adenylyltransferase (PPAT; EC 2.7.7.3) and dephospho-CoA kinase (DPCK; EC 2.7.1.24), in prokaryotes (Daugherty et al., 2002 [PubMed 11923312]
Mouse(71743) Coenzyme A synthase
Rat(287711) CoA synthase
Zebrafish(447838) Coenzyme A synthase
cow(100335995) CoA synthase
Horse(100066023) CoA synthase
dog(480517) CoA synthase
chicken(425550) CoA synthase
sheep(101102655) CoA synthase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027896 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027896 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027896 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_025233 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025233 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025233 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001042529 Rosetta Predictions human pricing
NM_001042530 Rosetta Predictions human pricing
NM_001042531 Rosetta Predictions human pricing
NM_001042532 Rosetta Predictions human pricing
NM_025233 Rosetta Predictions human pricing
NM_001006954 Rosetta Predictions rat pricing
NM_027896 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042529 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00310368 predicted 1116
2 SASI_Hs02_00310369 predicted 1073
3 SASI_Hs02_00310370 predicted 924
4 SASI_Hs02_00310371 predicted 1478
5 SASI_Hs02_00310372 predicted 1462
6 SASI_Hs02_00310373 predicted 1218
7 SASI_Hs02_00310374 predicted 1384
8 SASI_Hs02_00310375 predicted 749
9 SASI_Hs02_00310376 predicted 1916
10 SASI_Hs02_00310377 predicted 1674
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042530 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00310378 predicted 1373
2 SASI_Hs02_00310379 predicted 1332
3 SASI_Hs02_00310380 predicted 1172
4 SASI_Hs02_00310381 predicted 1731
5 SASI_Hs02_00310382 predicted 1720
6 SASI_Hs02_00310383 predicted 1469
7 SASI_Hs02_00310384 predicted 1637
8 SASI_Hs02_00310385 predicted 1004
9 SASI_Hs02_00310386 predicted 2170
10 SASI_Hs02_00310387 predicted 1921
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042531 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00310388 predicted 1478
2 SASI_Hs02_00310389 predicted 796
3 SASI_Hs02_00310390 predicted 1432
4 SASI_Hs02_00310391 predicted 1149
5 SASI_Hs02_00310392 predicted 1056
6 SASI_Hs02_00310393 predicted 1328
7 SASI_Hs02_00310394 predicted 896
8 SASI_Hs02_00310395 predicted 1059
9 SASI_Hs02_00310396 predicted 1226
10 SASI_Hs02_00310397 predicted 855
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042532 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00310398 predicted 1379
2 SASI_Hs02_00310399 predicted 1341
3 SASI_Hs02_00310400 predicted 1190
4 SASI_Hs02_00310401 predicted 1740
5 SASI_Hs02_00310402 predicted 1725
6 SASI_Hs02_00310403 predicted 1488
7 SASI_Hs02_00310404 predicted 1651
8 SASI_Hs02_00310405 predicted 1020
9 SASI_Hs02_00310406 predicted 2182
10 SASI_Hs02_00310407 predicted 1936
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025233 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00358044 predicted 1508
2 SASI_Hs01_00199237 predicted 1469
3 SASI_Hs01_00199238 predicted 1316
4 SASI_Hs01_00199239 predicted 1864
5 SASI_Hs01_00199240 predicted 1856
6 SASI_Hs01_00199241 predicted 1606
7 SASI_Hs01_00199242 predicted 1777
8 SASI_Hs01_00199243 predicted 1144
9 SASI_Hs02_00358045 predicted 2309
10 SASI_Hs01_00199245 predicted 2057
11 SASI_Hs01_00199236 predicted 635
12 SASI_Hs01_00199244 predicted 558
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001006954 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00042182 predicted 523
2 SASI_Rn01_00042183 predicted 1256
3 SASI_Rn01_00042184 predicted 1263
4 SASI_Rn01_00042185 predicted 459
5 SASI_Rn01_00042186 predicted 1272
6 SASI_Rn01_00042187 predicted 467
7 SASI_Rn01_00042188 predicted 1785
8 SASI_Rn01_00042189 predicted 203
9 SASI_Rn01_00042190 predicted 421
10 SASI_Rn02_00198502 predicted 1740
11 SASI_Rn01_00042191 predicted 298
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027896 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00176147 predicted 1616
2 SASI_Mm02_00332866 predicted 1777
3 SASI_Mm01_00176148 predicted 1150
4 SASI_Mm01_00176149 predicted 1680
5 SASI_Mm01_00176150 predicted 2099
6 SASI_Mm01_00176152 predicted 831
7 SASI_Mm01_00176153 predicted 2141
8 SASI_Mm01_00176155 predicted 830
9 SASI_Mm01_00176156 predicted 573
10 SASI_Mm02_00332867 predicted 628
11 SASI_Mm01_00176151 predicted 278
12 SASI_Mm01_00176154 predicted 1024
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027896
VALIDATED
COASY MISSION shRNA Bacterial Glycerol Stock
CoA synthase
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000024894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027896.1-998s1c1
Sequence:CCGGCGCCTTGAGAATGGCAAAGAACTCGAGTTCTTTGCCATTCTCAAGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027896.1-596s1c1
Sequence:CCGGGCCCTCTTACCCTCTACTATACTCGAGTATAGTAGAGGGTAAGAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027896.1-276s1c1
Sequence:CCGGCCACATTTGAGGTTCTGGATTCTCGAGAATCCAGAACCTCAAATGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027896.1-1225s1c1
Sequence:CCGGGCTGAAGAACTTGGGAGCATACTCGAGTATGCTCCCAAGTTCTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027896.1-191s1c1
Sequence:CCGGCTGGTGAATCACACCCTCTATCTCGAGATAGAGGGTGTGATTCACCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276691    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027896.4-2147s21c1
Sequence:CCGGCCTTGATGTTTACCCTCTATCCTCGAGGATAGAGGGTAAACATCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027896.4-564s21c1
Sequence:CCGGCCACATTTGAGGTTCTGGATTCTCGAGAATCCAGAACCTCAAATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027896.4-884s21c1
Sequence:CCGGGCCCTCTTACCCTCTACTATACTCGAGTATAGTAGAGGGTAAGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027896.4-1286s21c1
Sequence:CCGGCGCCTTGAGAATGGCAAAGAACTCGAGTTCTTTGCCATTCTCAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027896.4-830s21c1
Sequence:CCGGGTGTTGCTGTATCCGGATTATCTCGAGATAATCCGGATACAGCAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027896
VALIDATED
COASY MISSION shRNA shRNA Plasmid DNA
CoA synthase
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000024894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027896.1-998s1c1
Sequence:CCGGCGCCTTGAGAATGGCAAAGAACTCGAGTTCTTTGCCATTCTCAAGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027896.1-596s1c1
Sequence:CCGGGCCCTCTTACCCTCTACTATACTCGAGTATAGTAGAGGGTAAGAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027896.1-276s1c1
Sequence:CCGGCCACATTTGAGGTTCTGGATTCTCGAGAATCCAGAACCTCAAATGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027896.1-1225s1c1
Sequence:CCGGGCTGAAGAACTTGGGAGCATACTCGAGTATGCTCCCAAGTTCTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027896.1-191s1c1
Sequence:CCGGCTGGTGAATCACACCCTCTATCTCGAGATAGAGGGTGTGATTCACCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276691    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027896.4-2147s21c1
Sequence:CCGGCCTTGATGTTTACCCTCTATCCTCGAGGATAGAGGGTAAACATCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027896.4-564s21c1
Sequence:CCGGCCACATTTGAGGTTCTGGATTCTCGAGAATCCAGAACCTCAAATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027896.4-884s21c1
Sequence:CCGGGCCCTCTTACCCTCTACTATACTCGAGTATAGTAGAGGGTAAGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027896.4-1286s21c1
Sequence:CCGGCGCCTTGAGAATGGCAAAGAACTCGAGTTCTTTGCCATTCTCAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027896.4-830s21c1
Sequence:CCGGGTGTTGCTGTATCCGGATTATCTCGAGATAATCCGGATACAGCAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027896
VALIDATED
COASY MISSION shRNA Lentiviral Transduction Particles
CoA synthase
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000024894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027896.1-998s1c1
Sequence:CCGGCGCCTTGAGAATGGCAAAGAACTCGAGTTCTTTGCCATTCTCAAGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027896.1-596s1c1
Sequence:CCGGGCCCTCTTACCCTCTACTATACTCGAGTATAGTAGAGGGTAAGAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027896.1-276s1c1
Sequence:CCGGCCACATTTGAGGTTCTGGATTCTCGAGAATCCAGAACCTCAAATGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027896.1-1225s1c1
Sequence:CCGGGCTGAAGAACTTGGGAGCATACTCGAGTATGCTCCCAAGTTCTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027896.1-191s1c1
Sequence:CCGGCTGGTGAATCACACCCTCTATCTCGAGATAGAGGGTGTGATTCACCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276691    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027896.4-2147s21c1
Sequence:CCGGCCTTGATGTTTACCCTCTATCCTCGAGGATAGAGGGTAAACATCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027896.4-564s21c1
Sequence:CCGGCCACATTTGAGGTTCTGGATTCTCGAGAATCCAGAACCTCAAATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027896.4-884s21c1
Sequence:CCGGGCCCTCTTACCCTCTACTATACTCGAGTATAGTAGAGGGTAAGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027896.4-1286s21c1
Sequence:CCGGCGCCTTGAGAATGGCAAAGAACTCGAGTTCTTTGCCATTCTCAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027896.4-830s21c1
Sequence:CCGGGTGTTGCTGTATCCGGATTATCTCGAGATAATCCGGATACAGCAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025233
VALIDATED
COASY MISSION shRNA Bacterial Glycerol Stock
CoA synthase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000045613    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_025233.4-2299s1c1
Sequence:CCGGCCTACCCAACACGCTGGTATTCTCGAGAATACCAGCGTGTTGGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_025233.4-631s1c1
Sequence:CCGGGCCACGTTTGAGGTTCTTGATCTCGAGATCAAGAACCTCAAACGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_025233.4-547s1c1
Sequence:CCGGCTGGTGAATCACACACTCTATCTCGAGATAGAGTGTGTGATTCACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_025233.4-1192s1c1
Sequence:CCGGCGTGTGGAACATCTGAGTGAACTCGAGTTCACTCAGATGTTCCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_025233.4-1761s1c1
Sequence:CCGGGCTGAAGATACTCACGGACATCTCGAGATGTCCGTGAGTATCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_025233.5-1772s21c1
Sequence:GTACCGGAGGCCTTTGGAACAGATATTCCTCGAGGAATATCTGTTCCAAAGGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_025233.5-1857s21c1
Sequence:CCGGGCTGAAGATACTCACGGACATCTCGAGATGTCCGTGAGTATCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_025233.5-1288s21c1
Sequence:CCGGCGTGTGGAACATCTGAGTGAACTCGAGTTCACTCAGATGTTCCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333139    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_025233.5-2395s21c1
Sequence:CCGGCCTACCCAACACGCTGGTATTCTCGAGAATACCAGCGTGTTGGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_025233.5-727s21c1
Sequence:CCGGGCCACGTTTGAGGTTCTTGATCTCGAGATCAAGAACCTCAAACGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025233
VALIDATED
COASY MISSION shRNA shRNA Plasmid DNA
CoA synthase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000045613    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_025233.4-2299s1c1
Sequence:CCGGCCTACCCAACACGCTGGTATTCTCGAGAATACCAGCGTGTTGGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_025233.4-631s1c1
Sequence:CCGGGCCACGTTTGAGGTTCTTGATCTCGAGATCAAGAACCTCAAACGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_025233.4-547s1c1
Sequence:CCGGCTGGTGAATCACACACTCTATCTCGAGATAGAGTGTGTGATTCACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_025233.4-1192s1c1
Sequence:CCGGCGTGTGGAACATCTGAGTGAACTCGAGTTCACTCAGATGTTCCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_025233.4-1761s1c1
Sequence:CCGGGCTGAAGATACTCACGGACATCTCGAGATGTCCGTGAGTATCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_025233.5-1772s21c1
Sequence:GTACCGGAGGCCTTTGGAACAGATATTCCTCGAGGAATATCTGTTCCAAAGGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_025233.5-1857s21c1
Sequence:CCGGGCTGAAGATACTCACGGACATCTCGAGATGTCCGTGAGTATCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_025233.5-1288s21c1
Sequence:CCGGCGTGTGGAACATCTGAGTGAACTCGAGTTCACTCAGATGTTCCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333139    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_025233.5-2395s21c1
Sequence:CCGGCCTACCCAACACGCTGGTATTCTCGAGAATACCAGCGTGTTGGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_025233.5-727s21c1
Sequence:CCGGGCCACGTTTGAGGTTCTTGATCTCGAGATCAAGAACCTCAAACGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025233
VALIDATED
COASY MISSION shRNA Lentiviral Transduction Particles
CoA synthase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000045613    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_025233.4-2299s1c1
Sequence:CCGGCCTACCCAACACGCTGGTATTCTCGAGAATACCAGCGTGTTGGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_025233.4-631s1c1
Sequence:CCGGGCCACGTTTGAGGTTCTTGATCTCGAGATCAAGAACCTCAAACGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_025233.4-547s1c1
Sequence:CCGGCTGGTGAATCACACACTCTATCTCGAGATAGAGTGTGTGATTCACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_025233.4-1192s1c1
Sequence:CCGGCGTGTGGAACATCTGAGTGAACTCGAGTTCACTCAGATGTTCCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_025233.4-1761s1c1
Sequence:CCGGGCTGAAGATACTCACGGACATCTCGAGATGTCCGTGAGTATCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_025233.5-1772s21c1
Sequence:GTACCGGAGGCCTTTGGAACAGATATTCCTCGAGGAATATCTGTTCCAAAGGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_025233.5-1857s21c1
Sequence:CCGGGCTGAAGATACTCACGGACATCTCGAGATGTCCGTGAGTATCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_025233.5-1288s21c1
Sequence:CCGGCGTGTGGAACATCTGAGTGAACTCGAGTTCACTCAGATGTTCCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333139    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_025233.5-2395s21c1
Sequence:CCGGCCTACCCAACACGCTGGTATTCTCGAGAATACCAGCGTGTTGGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_025233.5-727s21c1
Sequence:CCGGGCCACGTTTGAGGTTCTTGATCTCGAGATCAAGAACCTCAAACGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks