EMAIL THIS PAGE TO A FRIEND

COBL

cordon-bleu WH2 repeat protein

152 Gene Product Result for
Gene ID:
Mouse(12808) cordon-bleu WH2 repeat
Rat(305497) cordon-bleu WH2 repeat protein
Zebrafish(497312) cordon-bleu homolog (mouse)
chicken(420949) cordon-bleu homolog (mouse)
domestic cat(101085960) cordon-bleu homolog (mouse)
cow(613554) cordon-bleu WH2 repeat protein
Horse(100066910) cordon-bleu homolog (mouse)
dog(607873) cordon-bleu homolog (mouse)
domestic guinea pig(100733187) cordon-bleu WH2 repeat protein
naked mole-rat(101707777) cordon-bleu WH2 repeat protein
sheep(101106517) cordon-bleu homolog (mouse)
Domestic Rabbit(100344734) cordon-bleu homolog (mouse)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015198 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015198 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015198 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172496 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172496 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172496 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015198 Rosetta Predictions human pricing
NM_001107236 Rosetta Predictions rat pricing
NM_172496 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015198 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00131307 predicted 2173
2 SASI_Hs01_00131308 predicted 2088
3 SASI_Hs01_00131309 predicted 950
4 SASI_Hs01_00131310 predicted 864
5 SASI_Hs01_00131314 predicted 632
6 SASI_Hs01_00131316 predicted 3550
7 SASI_Hs02_00347275 predicted 2486
8 SASI_Hs02_00347276 predicted 2329
9 SASI_Hs02_00347277 predicted 3037
10 SASI_Hs02_00347278 predicted 1550
11 SASI_Hs01_00131311 predicted 3752
12 SASI_Hs01_00131312 predicted 3079
13 SASI_Hs01_00131313 predicted 4002
14 SASI_Hs01_00131315 predicted 1771
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107236 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00226855 predicted 329
2 SASI_Rn02_00226856 predicted 2794
3 SASI_Rn02_00226857 predicted 2303
4 SASI_Rn02_00226858 predicted 3483
5 SASI_Rn02_00226859 predicted 732
6 SASI_Rn02_00226860 predicted 882
7 SASI_Rn02_00226861 predicted 959
8 SASI_Rn02_00226862 predicted 1706
9 SASI_Rn02_00226863 predicted 1769
10 SASI_Rn02_00226864 predicted 3037
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172496 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00070223 predicted 1087
2 SASI_Mm01_00070225 predicted 4322
3 SASI_Mm01_00070226 predicted 3397
4 SASI_Mm01_00070227 predicted 4277
5 SASI_Mm01_00070228 predicted 1990
6 SASI_Mm01_00070231 predicted 597
7 SASI_Mm01_00070232 predicted 4225
8 SASI_Mm02_00344079 predicted 1243
9 SASI_Mm02_00344080 predicted 1012
10 SASI_Mm01_00070230 predicted 2614
11 SASI_Mm01_00070224 predicted 3297
12 SASI_Mm01_00070229 predicted 2398
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015198
VALIDATED
COBL MISSION shRNA Bacterial Glycerol Stock
cordon-bleu WH2 repeat protein
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000335915    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015198.3-4522s21c1
Sequence:CCGGGCTGGATTCTTCTTCCTCAAACTCGAGTTTGAGGAAGAAGAATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015198.3-3393s21c1
Sequence:CCGGCCCAGTGTGTTCTCTACAGATCTCGAGATCTGTAGAGAACACACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015198.3-1618s21c1
Sequence:CCGGATGATGAAGAAGACCTATTAACTCGAGTTAATAGGTCTTCTTCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015198.3-2292s21c1
Sequence:CCGGCACGGCCTCACAACGTATAAACTCGAGTTTATACGTTGTGAGGCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015198.3-2025s21c1
Sequence:CCGGGCCTTATCTAACATCTCTAAACTCGAGTTTAGAGATGTTAGATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005529    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015198.2-4502s1c1
Sequence:CCGGGCTGGATTCTTCTTCCTCAAACTCGAGTTTGAGGAAGAAGAATCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015198.2-3374s1c1
Sequence:CCGGCCCAGTGTGTTCTCTACAGATCTCGAGATCTGTAGAGAACACACTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015198.2-616s1c1
Sequence:CCGGGCCTGAGAAATCTGTGCGTTTCTCGAGAAACGCACAGATTTCTCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015198.2-978s1c1
Sequence:CCGGCCATGCACTCACGTTCTCTTACTCGAGTAAGAGAACGTGAGTGCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015198.2-2006s1c1
Sequence:CCGGGCCTTATCTAACATCTCTAAACTCGAGTTTAGAGATGTTAGATAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015198
VALIDATED
COBL MISSION shRNA shRNA Plasmid DNA
cordon-bleu WH2 repeat protein
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000335915    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015198.3-4522s21c1
Sequence:CCGGGCTGGATTCTTCTTCCTCAAACTCGAGTTTGAGGAAGAAGAATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015198.3-3393s21c1
Sequence:CCGGCCCAGTGTGTTCTCTACAGATCTCGAGATCTGTAGAGAACACACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015198.3-1618s21c1
Sequence:CCGGATGATGAAGAAGACCTATTAACTCGAGTTAATAGGTCTTCTTCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015198.3-2292s21c1
Sequence:CCGGCACGGCCTCACAACGTATAAACTCGAGTTTATACGTTGTGAGGCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015198.3-2025s21c1
Sequence:CCGGGCCTTATCTAACATCTCTAAACTCGAGTTTAGAGATGTTAGATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005529    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015198.2-4502s1c1
Sequence:CCGGGCTGGATTCTTCTTCCTCAAACTCGAGTTTGAGGAAGAAGAATCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015198.2-3374s1c1
Sequence:CCGGCCCAGTGTGTTCTCTACAGATCTCGAGATCTGTAGAGAACACACTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015198.2-616s1c1
Sequence:CCGGGCCTGAGAAATCTGTGCGTTTCTCGAGAAACGCACAGATTTCTCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015198.2-978s1c1
Sequence:CCGGCCATGCACTCACGTTCTCTTACTCGAGTAAGAGAACGTGAGTGCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015198.2-2006s1c1
Sequence:CCGGGCCTTATCTAACATCTCTAAACTCGAGTTTAGAGATGTTAGATAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015198
VALIDATED
COBL MISSION shRNA Lentiviral Transduction Particles
cordon-bleu WH2 repeat protein
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000335915    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015198.3-4522s21c1
Sequence:CCGGGCTGGATTCTTCTTCCTCAAACTCGAGTTTGAGGAAGAAGAATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015198.3-3393s21c1
Sequence:CCGGCCCAGTGTGTTCTCTACAGATCTCGAGATCTGTAGAGAACACACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015198.3-1618s21c1
Sequence:CCGGATGATGAAGAAGACCTATTAACTCGAGTTAATAGGTCTTCTTCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015198.3-2292s21c1
Sequence:CCGGCACGGCCTCACAACGTATAAACTCGAGTTTATACGTTGTGAGGCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015198.3-2025s21c1
Sequence:CCGGGCCTTATCTAACATCTCTAAACTCGAGTTTAGAGATGTTAGATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005529    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015198.2-4502s1c1
Sequence:CCGGGCTGGATTCTTCTTCCTCAAACTCGAGTTTGAGGAAGAAGAATCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015198.2-3374s1c1
Sequence:CCGGCCCAGTGTGTTCTCTACAGATCTCGAGATCTGTAGAGAACACACTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015198.2-616s1c1
Sequence:CCGGGCCTGAGAAATCTGTGCGTTTCTCGAGAAACGCACAGATTTCTCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015198.2-978s1c1
Sequence:CCGGCCATGCACTCACGTTCTCTTACTCGAGTAAGAGAACGTGAGTGCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015198.2-2006s1c1
Sequence:CCGGGCCTTATCTAACATCTCTAAACTCGAGTTTAGAGATGTTAGATAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172496
COBL MISSION shRNA Bacterial Glycerol Stock
cordon-bleu WH2 repeat protein
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000182856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172496.2-953s1c1
Sequence:CCGGCCAACTCACCATCCTTGCATTCTCGAGAATGCAAGGATGGTGAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177543    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172496.2-4126s1c1
Sequence:CCGGCCAAGTATCATCACTTTAGAACTCGAGTTCTAAAGTGATGATACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172496.2-2189s1c1
Sequence:CCGGCCACAGTTACATCACTTGTTTCTCGAGAAACAAGTGATGTAACTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178003    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172496.2-463s1c1
Sequence:CCGGGTGCATACTGTACTTCTGAAACTCGAGTTTCAGAAGTACAGTATGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181669    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172496.2-2824s1c1
Sequence:CCGGGCAGTCTCTTGTTCTGTGAAACTCGAGTTTCACAGAACAAGAGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172496.2-2980s1c1
Sequence:CCGGGCAACCACTGAACAGTGTCATCTCGAGATGACACTGTTCAGTGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182450    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172496.2-328s1c1
Sequence:CCGGGCAATGATGGACCTACTGGTTCTCGAGAACCAGTAGGTCCATCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172496.2-2574s1c1
Sequence:CCGGCGAAACAGACACTCCACCTATCTCGAGATAGGTGGAGTGTCTGTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198735    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172496.2-3514s1c1
Sequence:CCGGCCCAGTTCGTTATCTACAGATCTCGAGATCTGTAGATAACGAACTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198686    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172496.2-2188s1c1
Sequence:CCGGCCCACAGTTACATCACTTGTTCTCGAGAACAAGTGATGTAACTGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172496
COBL MISSION shRNA shRNA Plasmid DNA
cordon-bleu WH2 repeat protein
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000182856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172496.2-953s1c1
Sequence:CCGGCCAACTCACCATCCTTGCATTCTCGAGAATGCAAGGATGGTGAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177543    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172496.2-4126s1c1
Sequence:CCGGCCAAGTATCATCACTTTAGAACTCGAGTTCTAAAGTGATGATACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172496.2-2189s1c1
Sequence:CCGGCCACAGTTACATCACTTGTTTCTCGAGAAACAAGTGATGTAACTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178003    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172496.2-463s1c1
Sequence:CCGGGTGCATACTGTACTTCTGAAACTCGAGTTTCAGAAGTACAGTATGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181669    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172496.2-2824s1c1
Sequence:CCGGGCAGTCTCTTGTTCTGTGAAACTCGAGTTTCACAGAACAAGAGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172496.2-2980s1c1
Sequence:CCGGGCAACCACTGAACAGTGTCATCTCGAGATGACACTGTTCAGTGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182450    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172496.2-328s1c1
Sequence:CCGGGCAATGATGGACCTACTGGTTCTCGAGAACCAGTAGGTCCATCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172496.2-2574s1c1
Sequence:CCGGCGAAACAGACACTCCACCTATCTCGAGATAGGTGGAGTGTCTGTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198735    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172496.2-3514s1c1
Sequence:CCGGCCCAGTTCGTTATCTACAGATCTCGAGATCTGTAGATAACGAACTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198686    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172496.2-2188s1c1
Sequence:CCGGCCCACAGTTACATCACTTGTTCTCGAGAACAAGTGATGTAACTGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172496
COBL MISSION shRNA Lentiviral Transduction Particles
cordon-bleu WH2 repeat protein
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000182856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172496.2-953s1c1
Sequence:CCGGCCAACTCACCATCCTTGCATTCTCGAGAATGCAAGGATGGTGAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177543    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172496.2-4126s1c1
Sequence:CCGGCCAAGTATCATCACTTTAGAACTCGAGTTCTAAAGTGATGATACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172496.2-2189s1c1
Sequence:CCGGCCACAGTTACATCACTTGTTTCTCGAGAAACAAGTGATGTAACTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178003    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172496.2-463s1c1
Sequence:CCGGGTGCATACTGTACTTCTGAAACTCGAGTTTCAGAAGTACAGTATGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181669    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172496.2-2824s1c1
Sequence:CCGGGCAGTCTCTTGTTCTGTGAAACTCGAGTTTCACAGAACAAGAGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172496.2-2980s1c1
Sequence:CCGGGCAACCACTGAACAGTGTCATCTCGAGATGACACTGTTCAGTGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182450    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172496.2-328s1c1
Sequence:CCGGGCAATGATGGACCTACTGGTTCTCGAGAACCAGTAGGTCCATCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172496.2-2574s1c1
Sequence:CCGGCGAAACAGACACTCCACCTATCTCGAGATAGGTGGAGTGTCTGTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198735    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172496.2-3514s1c1
Sequence:CCGGCCCAGTTCGTTATCTACAGATCTCGAGATCTGTAGATAACGAACTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198686    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172496.2-2188s1c1
Sequence:CCGGCCCACAGTTACATCACTTGTTCTCGAGAACAAGTGATGTAACTGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks