EMAIL THIS PAGE TO A FRIEND

COBLL1

cordon-bleu WH2 repeat protein-like 1

144 Gene Product Result for
Synonyms: COBLR1
Gene ID:
Mouse(319876) Cobl-like 1
Rat(311088) cordon-bleu WH2 repeat protein-like 1
chicken(424182) COBL-like 1
cow(532067) cordon-bleu WH2 repeat protein-like 1
Horse(100061847) COBL-like 1
dog(488375) COBL-like 1
sheep(101110310) COBL-like 1
naked mole-rat(101714215) cordon-bleu WH2 repeat protein-like 1
domestic guinea pig(100718068) cordon-bleu WH2 repeat protein-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177025 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177025 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177025 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014900 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014900 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014900 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014900 Rosetta Predictions human pricing
NM_001107733 Rosetta Predictions rat pricing
NM_027225 Rosetta Predictions mouse pricing
NM_177025 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014900 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00156891 predicted 456
2 SASI_Hs01_00156892 predicted 3497
3 SASI_Hs02_00346531 predicted 1844
4 SASI_Hs01_00156894 predicted 2019
5 SASI_Hs01_00156895 predicted 527
6 SASI_Hs01_00156896 predicted 508
7 SASI_Hs01_00156897 predicted 778
8 SASI_Hs01_00156898 predicted 2434
9 SASI_Hs01_00156899 predicted 2572
10 SASI_Hs01_00156900 predicted 2100
11 SASI_Hs01_00156893 predicted 2619
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107733 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00231735 predicted 443
2 SASI_Rn02_00231736 predicted 337
3 SASI_Rn02_00231737 predicted 481
4 SASI_Rn02_00231738 predicted 449
5 SASI_Rn02_00231739 predicted 536
6 SASI_Rn02_00231740 predicted 520
7 SASI_Rn02_00231741 predicted 552
8 SASI_Rn02_00231742 predicted 669
9 SASI_Rn02_00231743 predicted 599
10 SASI_Rn02_00231744 predicted 354
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027225 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00331778 predicted 3510
2 SASI_Mm02_00331779 predicted 2325
3 SASI_Mm02_00331780 predicted 841
4 SASI_Mm02_00331781 predicted 758
5 SASI_Mm02_00331782 predicted 413
6 SASI_Mm02_00331783 predicted 3218
7 SASI_Mm02_00331784 predicted 2206
8 SASI_Mm02_00331785 predicted 2243
9 SASI_Mm02_00331786 predicted 3078
10 SASI_Mm02_00331787 predicted 827
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177025 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00117593 predicted 3621
2 SASI_Mm01_00117595 predicted 2434
3 SASI_Mm02_00346976 predicted 848
4 SASI_Mm02_00346977 predicted 761
5 SASI_Mm01_00117597 predicted 412
6 SASI_Mm01_00117598 predicted 3337
7 SASI_Mm02_00346978 predicted 2319
8 SASI_Mm01_00117599 predicted 2347
9 SASI_Mm02_00346979 predicted 3185
10 SASI_Mm02_00346980 predicted 831
11 SASI_Mm01_00117591 predicted 1834
12 SASI_Mm01_00117592 predicted 366
13 SASI_Mm01_00117594 predicted 1663
14 SASI_Mm01_00117596 predicted 1679
15 SASI_Mm01_00117600 predicted 1704
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177025
COBLL1 MISSION shRNA Bacterial Glycerol Stock
cordon-bleu WH2 repeat protein-like 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000182665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177025.3-2362s1c1
Sequence:CCGGGCCAGCTTGTACATATGGGAACTCGAGTTCCCATATGTACAAGCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177025.3-1047s1c1
Sequence:CCGGCCATTTCCAAACCGTACATTTCTCGAGAAATGTACGGTTTGGAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177025.3-3822s1c1
Sequence:CCGGGAGTTACTGTTCCATCGAATACTCGAGTATTCGATGGAACAGTAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177025.3-2632s1c1
Sequence:CCGGGCAGAGGCATACGATTGAGAACTCGAGTTCTCAATCGTATGCCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197978    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177025.3-1042s1c1
Sequence:CCGGCAACACCATTTCCAAACCGTACTCGAGTACGGTTTGGAAATGGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197617    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177025.3-3317s1c1
Sequence:CCGGCTTCCTCTTGTATTTCCCAAACTCGAGTTTGGGAAATACAAGAGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216464    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177025.5-508s1c1
Sequence:CCGGGTCAAGTCACACAATTGATTTCTCGAGAAATCAATTGTGTGACTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216404    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177025.5-4617s1c1
Sequence:CCGGGATACATTGTGGCAGTTATTTCTCGAGAAATAACTGCCACAATGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216675    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177025.5-1802s1c1
Sequence:CCGGCATCCTGTTGTAGGCCATATACTCGAGTATATGGCCTACAACAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177025
COBLL1 MISSION shRNA shRNA Plasmid DNA
cordon-bleu WH2 repeat protein-like 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000182665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177025.3-2362s1c1
Sequence:CCGGGCCAGCTTGTACATATGGGAACTCGAGTTCCCATATGTACAAGCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177025.3-1047s1c1
Sequence:CCGGCCATTTCCAAACCGTACATTTCTCGAGAAATGTACGGTTTGGAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177025.3-3822s1c1
Sequence:CCGGGAGTTACTGTTCCATCGAATACTCGAGTATTCGATGGAACAGTAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177025.3-2632s1c1
Sequence:CCGGGCAGAGGCATACGATTGAGAACTCGAGTTCTCAATCGTATGCCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197978    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177025.3-1042s1c1
Sequence:CCGGCAACACCATTTCCAAACCGTACTCGAGTACGGTTTGGAAATGGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197617    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177025.3-3317s1c1
Sequence:CCGGCTTCCTCTTGTATTTCCCAAACTCGAGTTTGGGAAATACAAGAGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216464    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177025.5-508s1c1
Sequence:CCGGGTCAAGTCACACAATTGATTTCTCGAGAAATCAATTGTGTGACTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216404    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177025.5-4617s1c1
Sequence:CCGGGATACATTGTGGCAGTTATTTCTCGAGAAATAACTGCCACAATGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216675    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177025.5-1802s1c1
Sequence:CCGGCATCCTGTTGTAGGCCATATACTCGAGTATATGGCCTACAACAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177025
COBLL1 MISSION shRNA Lentiviral Transduction Particles
cordon-bleu WH2 repeat protein-like 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000182665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177025.3-2362s1c1
Sequence:CCGGGCCAGCTTGTACATATGGGAACTCGAGTTCCCATATGTACAAGCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177025.3-1047s1c1
Sequence:CCGGCCATTTCCAAACCGTACATTTCTCGAGAAATGTACGGTTTGGAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177025.3-3822s1c1
Sequence:CCGGGAGTTACTGTTCCATCGAATACTCGAGTATTCGATGGAACAGTAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177025.3-2632s1c1
Sequence:CCGGGCAGAGGCATACGATTGAGAACTCGAGTTCTCAATCGTATGCCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197978    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177025.3-1042s1c1
Sequence:CCGGCAACACCATTTCCAAACCGTACTCGAGTACGGTTTGGAAATGGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197617    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177025.3-3317s1c1
Sequence:CCGGCTTCCTCTTGTATTTCCCAAACTCGAGTTTGGGAAATACAAGAGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216464    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177025.5-508s1c1
Sequence:CCGGGTCAAGTCACACAATTGATTTCTCGAGAAATCAATTGTGTGACTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216404    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177025.5-4617s1c1
Sequence:CCGGGATACATTGTGGCAGTTATTTCTCGAGAAATAACTGCCACAATGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216675    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177025.5-1802s1c1
Sequence:CCGGCATCCTGTTGTAGGCCATATACTCGAGTATATGGCCTACAACAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014900
VALIDATED
COBLL1 MISSION shRNA Bacterial Glycerol Stock
cordon-bleu WH2 repeat protein-like 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014900.2-3859s1c1
Sequence:CCGGGCACATGGTAATGATGATCTTCTCGAGAAGATCATCATTACCATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014900.2-5159s1c1
Sequence:CCGGGAAGGTCAAGACTCAGCCATTCTCGAGAATGGCTGAGTCTTGACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_014900.2-3071s1c1
Sequence:CCGGGCCTTGAAGAGATAGATGAAACTCGAGTTTCATCTATCTCTTCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_014900.2-3508s1c1
Sequence:CCGGCCATCAAACTCTGAGGCACATCTCGAGATGTGCCTCAGAGTTTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_014900.2-4440s1c1
Sequence:CCGGGAAGAGAGTATCGGGTCACTACTCGAGTAGTGACCCGATACTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139847    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014900.2-3020s1c1
Sequence:CCGGCAAACTCTCCTGAGGAGCTATCTCGAGATAGCTCCTCAGGAGAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432295    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014900.3-3936s21c1
Sequence:CCGGATATGCTGCTTTAGAACTTTACTCGAGTAAAGTTCTAAAGCAGCATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427138    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014900.3-4133s21c1
Sequence:CCGGGTGTAGCAATTGGAAATATTTCTCGAGAAATATTTCCAATTGCTACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014900.3-2310s21c1
Sequence:CCGGGAGTCAAGGCACCCTAATTATCTCGAGATAATTAGGGTGCCTTGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014900.3-1045s21c1
Sequence:CCGGACCATTTCCAAACCATATATTCTCGAGAATATATGGTTTGGAAATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014900.3-769s21c1
Sequence:CCGGGATCCGTTGCATACACTATTGCTCGAGCAATAGTGTATGCAACGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014900
VALIDATED
COBLL1 MISSION shRNA shRNA Plasmid DNA
cordon-bleu WH2 repeat protein-like 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014900.2-3859s1c1
Sequence:CCGGGCACATGGTAATGATGATCTTCTCGAGAAGATCATCATTACCATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014900.2-5159s1c1
Sequence:CCGGGAAGGTCAAGACTCAGCCATTCTCGAGAATGGCTGAGTCTTGACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_014900.2-3071s1c1
Sequence:CCGGGCCTTGAAGAGATAGATGAAACTCGAGTTTCATCTATCTCTTCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_014900.2-3508s1c1
Sequence:CCGGCCATCAAACTCTGAGGCACATCTCGAGATGTGCCTCAGAGTTTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_014900.2-4440s1c1
Sequence:CCGGGAAGAGAGTATCGGGTCACTACTCGAGTAGTGACCCGATACTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139847    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014900.2-3020s1c1
Sequence:CCGGCAAACTCTCCTGAGGAGCTATCTCGAGATAGCTCCTCAGGAGAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432295    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014900.3-3936s21c1
Sequence:CCGGATATGCTGCTTTAGAACTTTACTCGAGTAAAGTTCTAAAGCAGCATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427138    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014900.3-4133s21c1
Sequence:CCGGGTGTAGCAATTGGAAATATTTCTCGAGAAATATTTCCAATTGCTACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014900.3-2310s21c1
Sequence:CCGGGAGTCAAGGCACCCTAATTATCTCGAGATAATTAGGGTGCCTTGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014900.3-1045s21c1
Sequence:CCGGACCATTTCCAAACCATATATTCTCGAGAATATATGGTTTGGAAATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014900.3-769s21c1
Sequence:CCGGGATCCGTTGCATACACTATTGCTCGAGCAATAGTGTATGCAACGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014900
VALIDATED
COBLL1 MISSION shRNA Lentiviral Transduction Particles
cordon-bleu WH2 repeat protein-like 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014900.2-3859s1c1
Sequence:CCGGGCACATGGTAATGATGATCTTCTCGAGAAGATCATCATTACCATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014900.2-5159s1c1
Sequence:CCGGGAAGGTCAAGACTCAGCCATTCTCGAGAATGGCTGAGTCTTGACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_014900.2-3071s1c1
Sequence:CCGGGCCTTGAAGAGATAGATGAAACTCGAGTTTCATCTATCTCTTCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_014900.2-3508s1c1
Sequence:CCGGCCATCAAACTCTGAGGCACATCTCGAGATGTGCCTCAGAGTTTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_014900.2-4440s1c1
Sequence:CCGGGAAGAGAGTATCGGGTCACTACTCGAGTAGTGACCCGATACTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139847    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014900.2-3020s1c1
Sequence:CCGGCAAACTCTCCTGAGGAGCTATCTCGAGATAGCTCCTCAGGAGAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432295    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014900.3-3936s21c1
Sequence:CCGGATATGCTGCTTTAGAACTTTACTCGAGTAAAGTTCTAAAGCAGCATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427138    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014900.3-4133s21c1
Sequence:CCGGGTGTAGCAATTGGAAATATTTCTCGAGAAATATTTCCAATTGCTACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014900.3-2310s21c1
Sequence:CCGGGAGTCAAGGCACCCTAATTATCTCGAGATAATTAGGGTGCCTTGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014900.3-1045s21c1
Sequence:CCGGACCATTTCCAAACCATATATTCTCGAGAATATATGGTTTGGAAATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014900.3-769s21c1
Sequence:CCGGGATCCGTTGCATACACTATTGCTCGAGCAATAGTGTATGCAACGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks