EMAIL THIS PAGE TO A FRIEND

COCH

cochlin

64 Gene Product Result for
Synonyms: COCH-5B2 COCH5B2 DFNA9
UniProtKB ID: O43405, A8K9K9, D3DS84
Gene ID:
Human(1690) Summary: The protein encoded by this gene is highly conserved in human, mouse, and chicken, showing 94% and 79% amino acid identity of human to mouse and chicken sequences, respectively. Hybridization to this gene was detected in spindle-shaped cells located along nerve fibers between the auditory ganglion and sensory epithelium. These cells accompany neurites at the habenula perforata, the opening through which neurites extend to innervate hair cells. This and the pattern of expression of this gene in chicken inner ear paralleled the histologic findings of acidophilic deposits, consistent with mucopolysaccharide ground substance, in temporal bones from DFNA9 (autosomal dominant nonsyndromic sensorineural deafness 9) patients. Mutations that cause DFNA9 have been reported in this gene. Alternative splicing results in multiple transcript variants encoding the same protein. Additional splice variants encoding distinct isoforms have been described but their biological validities have not been demonstrated. [provided by RefSeq, Oct 2008]
Mouse(12810) coagulation factor C homolog (Limulus polyphemus)
Rat(362735) cochlin
sheep(101102269) coagulation factor C homolog, cochlin (Limulus polyphemus)
Domestic Rabbit(100351943) coagulation factor C homolog, cochlin (Limulus polyphemus)
domestic guinea pig(100174920) coagulation factor C homolog (Limulus polyphemus)
Zebrafish(368851) coagulation factor C homolog, cochlin (Limulus polyphemus)
chicken(395779) coagulation factor C homolog, cochlin (Limulus polyphemus)
cow(504316) coagulation factor C homolog, cochlin (Limulus polyphemus)
Horse(100055742) coagulation factor C homolog, cochlin (Limulus polyphemus)
domestic cat(101081053) coagulation factor C homolog, cochlin (Limulus polyphemus)
dog(490640) coagulation factor C homolog, cochlin (Limulus polyphemus)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007728 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007728 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007728 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004086 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004086 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004086 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004086 Rosetta Predictions human pricing
NM_001108710 Rosetta Predictions rat pricing
NM_007728 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004086 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00229989 predicted 1179
2 SASI_Hs01_00229990 predicted 1641
3 SASI_Hs01_00229991 predicted 1690
4 SASI_Hs01_00229992 predicted 554
5 SASI_Hs01_00229994 predicted 1365
6 SASI_Hs02_00336881 predicted 1482
7 SASI_Hs02_00336882 predicted 1466
8 SASI_Hs01_00229996 predicted 1192
9 SASI_Hs02_00336883 predicted 1459
10 SASI_Hs02_00336884 predicted 228
11 SASI_Hs01_00229988 predicted 924
12 SASI_Hs01_00229993 predicted 662
13 SASI_Hs01_00229995 predicted 981
14 SASI_Hs01_00229997 predicted 1023
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108710 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00241315 predicted 347
2 SASI_Rn02_00241316 predicted 403
3 SASI_Rn02_00241317 predicted 409
4 SASI_Rn02_00241318 predicted 334
5 SASI_Rn02_00241319 predicted 378
6 SASI_Rn02_00241320 predicted 355
7 SASI_Rn02_00241321 predicted 406
8 SASI_Rn02_00241322 predicted 396
9 SASI_Rn02_00241323 predicted 340
10 SASI_Rn02_00241324 predicted 415
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007728 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00144454 predicted 1815
2 SASI_Mm01_00144455 predicted 1037
3 SASI_Mm01_00144456 predicted 1301
4 SASI_Mm01_00144457 predicted 1862
5 SASI_Mm01_00144458 predicted 656
6 SASI_Mm01_00144459 predicted 1140
7 SASI_Mm01_00144460 predicted 667
8 SASI_Mm01_00144461 predicted 1483
9 SASI_Mm01_00144462 predicted 1590
10 SASI_Mm01_00144463 predicted 1707
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007728
COCH MISSION shRNA Bacterial Glycerol Stock
cochlin
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007728.4-1131s21c1
Sequence:CCGGACAAGGCTGTGTGTCGGAATACTCGAGTATTCCGACACACAGCCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427420    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007728.4-2269s21c1
Sequence:CCGGTAGCCATAACTACACATTATACTCGAGTATAATGTGTAGTTATGGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007728.4-1430s21c1
Sequence:CCCGTTCAGTTTCACTGACTATAATCTCGAGATTATAGTCAGTGAAACTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434763    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007728.4-1863s21c1
Sequence:CCGGGGGATCTAATGTGCAAATTATCTCGAGATAATTTGCACATTAGATCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007728.4-1045s21c1
Sequence:CCGGAGAGTTTGGTGTCAATGTATTCTCGAGAATACATTGACACCAAACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099875    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007728.2-2134s1c1
Sequence:CCGGCCCTCTTTAATCACTCTGCATCTCGAGATGCAGAGTGATTAAAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007728.2-1700s1c1
Sequence:CCGGCCTGAGAGATATGGCCTCTAACTCGAGTTAGAGGCCATATCTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007728.2-1327s1c1
Sequence:CCGGGCCTCATGCTAGAATTTGTTTCTCGAGAAACAAATTCTAGCATGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007728.2-710s1c1
Sequence:CCGGGCGCCGATTTAATTTGCAGAACTCGAGTTCTGCAAATTAAATCGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007728
COCH MISSION shRNA shRNA Plasmid DNA
cochlin
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007728.4-1131s21c1
Sequence:CCGGACAAGGCTGTGTGTCGGAATACTCGAGTATTCCGACACACAGCCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427420    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007728.4-2269s21c1
Sequence:CCGGTAGCCATAACTACACATTATACTCGAGTATAATGTGTAGTTATGGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007728.4-1430s21c1
Sequence:CCCGTTCAGTTTCACTGACTATAATCTCGAGATTATAGTCAGTGAAACTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434763    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007728.4-1863s21c1
Sequence:CCGGGGGATCTAATGTGCAAATTATCTCGAGATAATTTGCACATTAGATCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007728.4-1045s21c1
Sequence:CCGGAGAGTTTGGTGTCAATGTATTCTCGAGAATACATTGACACCAAACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099875    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007728.2-2134s1c1
Sequence:CCGGCCCTCTTTAATCACTCTGCATCTCGAGATGCAGAGTGATTAAAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007728.2-1700s1c1
Sequence:CCGGCCTGAGAGATATGGCCTCTAACTCGAGTTAGAGGCCATATCTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007728.2-1327s1c1
Sequence:CCGGGCCTCATGCTAGAATTTGTTTCTCGAGAAACAAATTCTAGCATGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007728.2-710s1c1
Sequence:CCGGGCGCCGATTTAATTTGCAGAACTCGAGTTCTGCAAATTAAATCGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007728
COCH MISSION shRNA Lentiviral Transduction Particles
cochlin
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007728.4-1131s21c1
Sequence:CCGGACAAGGCTGTGTGTCGGAATACTCGAGTATTCCGACACACAGCCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427420    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007728.4-2269s21c1
Sequence:CCGGTAGCCATAACTACACATTATACTCGAGTATAATGTGTAGTTATGGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007728.4-1430s21c1
Sequence:CCCGTTCAGTTTCACTGACTATAATCTCGAGATTATAGTCAGTGAAACTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434763    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007728.4-1863s21c1
Sequence:CCGGGGGATCTAATGTGCAAATTATCTCGAGATAATTTGCACATTAGATCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007728.4-1045s21c1
Sequence:CCGGAGAGTTTGGTGTCAATGTATTCTCGAGAATACATTGACACCAAACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099875    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007728.2-2134s1c1
Sequence:CCGGCCCTCTTTAATCACTCTGCATCTCGAGATGCAGAGTGATTAAAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007728.2-1700s1c1
Sequence:CCGGCCTGAGAGATATGGCCTCTAACTCGAGTTAGAGGCCATATCTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007728.2-1327s1c1
Sequence:CCGGGCCTCATGCTAGAATTTGTTTCTCGAGAAACAAATTCTAGCATGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007728.2-710s1c1
Sequence:CCGGGCGCCGATTTAATTTGCAGAACTCGAGTTCTGCAAATTAAATCGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004086
VALIDATED
COCH MISSION shRNA Bacterial Glycerol Stock
cochlin
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000299687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_004086.2-614s21c1
Sequence:CCGGGCGCCGATTTAATTTACAGAACTCGAGTTCTGTAAATTAAATCGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299686    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_004086.2-1889s21c1
Sequence:CCGGCGCTGCCTTCTGGTTACAATTCTCGAGAATTGTAACCAGAAGGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004086.2-1207s21c1
Sequence:CCGGGCAGTGTTGGAGATAGCAATTCTCGAGAATTGCTATCTCCAACACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004086.2-1230s21c1
Sequence:CCGGCGCCTCATGCTTGAATTTGTTCTCGAGAACAAATTCAAGCATGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_004086.2-834s21c1
Sequence:CCGGGCTCAGAAATTCTTCACGGTACTCGAGTACCGTGAAGAATTTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118727    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_004086.1-1865s1c1
Sequence:CCGGCGCTGCCTTCTGGTTACAATTCTCGAGAATTGTAACCAGAAGGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_004086.1-590s1c1
Sequence:CCGGGCGCCGATTTAATTTACAGAACTCGAGTTCTGTAAATTAAATCGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_004086.1-1206s1c1
Sequence:CCGGCGCCTCATGCTTGAATTTGTTCTCGAGAACAAATTCAAGCATGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004086.1-810s1c1
Sequence:CCGGGCTCAGAAATTCTTCACGGTACTCGAGTACCGTGAAGAATTTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_004086.1-1183s1c1
Sequence:CCGGGCAGTGTTGGAGATAGCAATTCTCGAGAATTGCTATCTCCAACACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004086
VALIDATED
COCH MISSION shRNA shRNA Plasmid DNA
cochlin
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000299687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_004086.2-614s21c1
Sequence:CCGGGCGCCGATTTAATTTACAGAACTCGAGTTCTGTAAATTAAATCGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299686    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_004086.2-1889s21c1
Sequence:CCGGCGCTGCCTTCTGGTTACAATTCTCGAGAATTGTAACCAGAAGGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004086.2-1207s21c1
Sequence:CCGGGCAGTGTTGGAGATAGCAATTCTCGAGAATTGCTATCTCCAACACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004086.2-1230s21c1
Sequence:CCGGCGCCTCATGCTTGAATTTGTTCTCGAGAACAAATTCAAGCATGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_004086.2-834s21c1
Sequence:CCGGGCTCAGAAATTCTTCACGGTACTCGAGTACCGTGAAGAATTTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118727    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_004086.1-1865s1c1
Sequence:CCGGCGCTGCCTTCTGGTTACAATTCTCGAGAATTGTAACCAGAAGGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_004086.1-590s1c1
Sequence:CCGGGCGCCGATTTAATTTACAGAACTCGAGTTCTGTAAATTAAATCGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_004086.1-1206s1c1
Sequence:CCGGCGCCTCATGCTTGAATTTGTTCTCGAGAACAAATTCAAGCATGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004086.1-810s1c1
Sequence:CCGGGCTCAGAAATTCTTCACGGTACTCGAGTACCGTGAAGAATTTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_004086.1-1183s1c1
Sequence:CCGGGCAGTGTTGGAGATAGCAATTCTCGAGAATTGCTATCTCCAACACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004086
VALIDATED
COCH MISSION shRNA Lentiviral Transduction Particles
cochlin
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000299687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_004086.2-614s21c1
Sequence:CCGGGCGCCGATTTAATTTACAGAACTCGAGTTCTGTAAATTAAATCGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299686    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_004086.2-1889s21c1
Sequence:CCGGCGCTGCCTTCTGGTTACAATTCTCGAGAATTGTAACCAGAAGGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004086.2-1207s21c1
Sequence:CCGGGCAGTGTTGGAGATAGCAATTCTCGAGAATTGCTATCTCCAACACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004086.2-1230s21c1
Sequence:CCGGCGCCTCATGCTTGAATTTGTTCTCGAGAACAAATTCAAGCATGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_004086.2-834s21c1
Sequence:CCGGGCTCAGAAATTCTTCACGGTACTCGAGTACCGTGAAGAATTTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118727    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_004086.1-1865s1c1
Sequence:CCGGCGCTGCCTTCTGGTTACAATTCTCGAGAATTGTAACCAGAAGGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_004086.1-590s1c1
Sequence:CCGGGCGCCGATTTAATTTACAGAACTCGAGTTCTGTAAATTAAATCGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_004086.1-1206s1c1
Sequence:CCGGCGCCTCATGCTTGAATTTGTTCTCGAGAACAAATTCAAGCATGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004086.1-810s1c1
Sequence:CCGGGCTCAGAAATTCTTCACGGTACTCGAGTACCGTGAAGAATTTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_004086.1-1183s1c1
Sequence:CCGGGCAGTGTTGGAGATAGCAATTCTCGAGAATTGCTATCTCCAACACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks