EMAIL THIS PAGE TO A FRIEND

COG1

component of oligomeric golgi complex 1

61 Gene Product Result for
Synonyms: CDG2G LDLB
UniProtKB ID: Q8WTW3, Q9NPV9, Q9P2G6
Gene ID:
Human(9382) Summary: The protein encoded by this gene is one of eight proteins (Cog1-8) which form a Golgi-localized complex (COG) required for normal Golgi morphology and function. It is thought that this protein is required for steps in the normal medial and trans Golgi-associated processing of glycoconjugates and plays a role in the organization of the Golgi-localized complex. [provided by RefSeq, Jul 2008]
Mouse(16834) component of oligomeric golgi complex 1
Rat(303652) component of oligomeric golgi complex 1
Zebrafish(100334475) component of oligomeric golgi complex 1
cow(515788) component of oligomeric golgi complex 1
Horse(100061294) component of oligomeric golgi complex 1
domestic cat(101091235) component of oligomeric golgi complex 1
dog(483282) component of oligomeric golgi complex 1
chicken(417449) component of oligomeric golgi complex 1
sheep(101107716) component of oligomeric golgi complex 1
naked mole-rat(101714587) component of oligomeric golgi complex 1
domestic guinea pig(100716779) component of oligomeric golgi complex 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018714 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018714 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018714 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013581 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013581 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013581 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018714 Rosetta Predictions human pricing
NM_001107062 Rosetta Predictions rat pricing
NM_013581 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018714 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00063486 predicted 667
2 SASI_Hs01_00063487 predicted 1591
3 SASI_Hs01_00063489 predicted 1428
4 SASI_Hs01_00063490 predicted 2126
5 SASI_Hs02_00352250 predicted 2383
6 SASI_Hs01_00063491 predicted 2408
7 SASI_Hs02_00352251 predicted 1690
8 SASI_Hs01_00063493 predicted 2356
9 SASI_Hs01_00063494 predicted 2747
10 SASI_Hs01_00063495 predicted 591
11 SASI_Hs01_00063488 predicted 1313
12 SASI_Hs01_00063492 predicted 1956
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107062 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00225116 predicted 1346
2 SASI_Rn02_00225117 predicted 892
3 SASI_Rn02_00225118 predicted 2399
4 SASI_Rn02_00225119 predicted 1292
5 SASI_Rn02_00225120 predicted 944
6 SASI_Rn02_00225121 predicted 1303
7 SASI_Rn02_00225122 predicted 2036
8 SASI_Rn02_00225123 predicted 1434
9 SASI_Rn02_00225124 predicted 2770
10 SASI_Rn02_00225125 predicted 2741
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013581 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00070443 predicted 1386
2 SASI_Mm01_00070444 predicted 733
3 SASI_Mm01_00070445 predicted 1096
4 SASI_Mm02_00322319 predicted 1325
5 SASI_Mm01_00070447 predicted 1581
6 SASI_Mm01_00070448 predicted 1128
7 SASI_Mm01_00070450 predicted 1180
8 SASI_Mm01_00070449 predicted 1060
9 SASI_Mm01_00070452 predicted 669
10 SASI_Mm02_00322320 predicted 409
11 SASI_Mm01_00070446 predicted 2154
12 SASI_Mm01_00070451 predicted 1689
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018714
COG1 MISSION shRNA Bacterial Glycerol Stock
component of oligomeric golgi complex 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000165579    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018714.1-2313s1c1
Sequence:CCGGGCCTTGCCAAAGGTGACATTACTCGAGTAATGTCACCTTTGGCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161915    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018714.1-2785s1c1
Sequence:CCGGGCACTCGAAAGGCTAAATCAACTCGAGTTGATTTAGCCTTTCGAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161144    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018714.1-2634s1c1
Sequence:CCGGCAGCGAACTTCTGTTCTGTTTCTCGAGAAACAGAACAGAAGTTCGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161818    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018714.1-1284s1c1
Sequence:CCGGCAACTGTTCCTTGACCGATTACTCGAGTAATCGGTCAAGGAACAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164716    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018714.1-1586s1c1
Sequence:CCGGCCTGGATTCTAAGCTGAAGGTCTCGAGACCTTCAGCTTAGAATCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164896    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018714.1-2373s1c1
Sequence:CCGGGCCTATGAGAAACTCTCCGAACTCGAGTTCGGAGAGTTTCTCATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165063    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018714.1-771s1c1
Sequence:CCGGGCTGGTATCAAGGCTCAGATTCTCGAGAATCTGAGCCTTGATACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165011    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018714.1-2739s1c1
Sequence:CCGGGCATCCAGTCAGATCAGGTTTCTCGAGAAACCTGATCTGACTGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164931    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018714.1-1283s1c1
Sequence:CCGGGCAACTGTTCCTTGACCGATTCTCGAGAATCGGTCAAGGAACAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165546    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018714.1-2633s1c1
Sequence:CCGGGCAGCGAACTTCTGTTCTGTTCTCGAGAACAGAACAGAAGTTCGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018714
COG1 MISSION shRNA shRNA Plasmid DNA
component of oligomeric golgi complex 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000165579    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018714.1-2313s1c1
Sequence:CCGGGCCTTGCCAAAGGTGACATTACTCGAGTAATGTCACCTTTGGCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161915    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018714.1-2785s1c1
Sequence:CCGGGCACTCGAAAGGCTAAATCAACTCGAGTTGATTTAGCCTTTCGAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161144    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018714.1-2634s1c1
Sequence:CCGGCAGCGAACTTCTGTTCTGTTTCTCGAGAAACAGAACAGAAGTTCGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161818    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018714.1-1284s1c1
Sequence:CCGGCAACTGTTCCTTGACCGATTACTCGAGTAATCGGTCAAGGAACAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164716    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018714.1-1586s1c1
Sequence:CCGGCCTGGATTCTAAGCTGAAGGTCTCGAGACCTTCAGCTTAGAATCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164896    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018714.1-2373s1c1
Sequence:CCGGGCCTATGAGAAACTCTCCGAACTCGAGTTCGGAGAGTTTCTCATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165063    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018714.1-771s1c1
Sequence:CCGGGCTGGTATCAAGGCTCAGATTCTCGAGAATCTGAGCCTTGATACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165011    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018714.1-2739s1c1
Sequence:CCGGGCATCCAGTCAGATCAGGTTTCTCGAGAAACCTGATCTGACTGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164931    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018714.1-1283s1c1
Sequence:CCGGGCAACTGTTCCTTGACCGATTCTCGAGAATCGGTCAAGGAACAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165546    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018714.1-2633s1c1
Sequence:CCGGGCAGCGAACTTCTGTTCTGTTCTCGAGAACAGAACAGAAGTTCGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018714
COG1 MISSION shRNA Lentiviral Transduction Particles
component of oligomeric golgi complex 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000165579    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018714.1-2313s1c1
Sequence:CCGGGCCTTGCCAAAGGTGACATTACTCGAGTAATGTCACCTTTGGCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161915    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018714.1-2785s1c1
Sequence:CCGGGCACTCGAAAGGCTAAATCAACTCGAGTTGATTTAGCCTTTCGAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161144    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018714.1-2634s1c1
Sequence:CCGGCAGCGAACTTCTGTTCTGTTTCTCGAGAAACAGAACAGAAGTTCGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161818    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018714.1-1284s1c1
Sequence:CCGGCAACTGTTCCTTGACCGATTACTCGAGTAATCGGTCAAGGAACAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164716    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018714.1-1586s1c1
Sequence:CCGGCCTGGATTCTAAGCTGAAGGTCTCGAGACCTTCAGCTTAGAATCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164896    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018714.1-2373s1c1
Sequence:CCGGGCCTATGAGAAACTCTCCGAACTCGAGTTCGGAGAGTTTCTCATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165063    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018714.1-771s1c1
Sequence:CCGGGCTGGTATCAAGGCTCAGATTCTCGAGAATCTGAGCCTTGATACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165011    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018714.1-2739s1c1
Sequence:CCGGGCATCCAGTCAGATCAGGTTTCTCGAGAAACCTGATCTGACTGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164931    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018714.1-1283s1c1
Sequence:CCGGGCAACTGTTCCTTGACCGATTCTCGAGAATCGGTCAAGGAACAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165546    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018714.1-2633s1c1
Sequence:CCGGGCAGCGAACTTCTGTTCTGTTCTCGAGAACAGAACAGAAGTTCGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013581
VALIDATED
COG1 MISSION shRNA Bacterial Glycerol Stock
component of oligomeric golgi complex 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000126474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013581.2-1885s1c1
Sequence:CCGGCCTCACCTAAAGCAGTGCATTCTCGAGAATGCACTGCTTTAGGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013581.2-2616s1c1
Sequence:CCGGGCAGCGGACTTCAGTTCTATTCTCGAGAATAGAACTGAAGTCCGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013581.2-1567s1c1
Sequence:CCGGCTGGATTCTAAGCTGAAGGTTCTCGAGAACCTTCAGCTTAGAATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013581.2-588s1c1
Sequence:CCGGCGAAAGCAAGATGCTGCTCAACTCGAGTTGAGCAGCATCTTGCTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013581.2-1676s1c1
Sequence:CCGGCCTTTGATAGATACGCAGATACTCGAGTATCTGCGTATCTATCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013581.3-580s21c1
Sequence:CCGGGCCACTTCCGGTCAACTATTTCTCGAGAAATAGTTGACCGGAAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013581.3-1587s21c1
Sequence:CCGGGATTCTAAGCTGAAGGTTAAACTCGAGTTTAACCTTCAGCTTAGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013581.3-2633s21c1
Sequence:CCGGGCAGCGGACTTCAGTTCTATTCTCGAGAATAGAACTGAAGTCCGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013581.3-1098s21c1
Sequence:CCGGATGTGCAATGAAGACATTAAACTCGAGTTTAATGTCTTCATTGCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013581.3-723s21c1
Sequence:CCGGCTGGCCAGAAAGGCGACTATTCTCGAGAATAGTCGCCTTTCTGGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013581
VALIDATED
COG1 MISSION shRNA shRNA Plasmid DNA
component of oligomeric golgi complex 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000126474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013581.2-1885s1c1
Sequence:CCGGCCTCACCTAAAGCAGTGCATTCTCGAGAATGCACTGCTTTAGGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013581.2-2616s1c1
Sequence:CCGGGCAGCGGACTTCAGTTCTATTCTCGAGAATAGAACTGAAGTCCGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013581.2-1567s1c1
Sequence:CCGGCTGGATTCTAAGCTGAAGGTTCTCGAGAACCTTCAGCTTAGAATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013581.2-588s1c1
Sequence:CCGGCGAAAGCAAGATGCTGCTCAACTCGAGTTGAGCAGCATCTTGCTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013581.2-1676s1c1
Sequence:CCGGCCTTTGATAGATACGCAGATACTCGAGTATCTGCGTATCTATCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013581.3-580s21c1
Sequence:CCGGGCCACTTCCGGTCAACTATTTCTCGAGAAATAGTTGACCGGAAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013581.3-1587s21c1
Sequence:CCGGGATTCTAAGCTGAAGGTTAAACTCGAGTTTAACCTTCAGCTTAGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013581.3-2633s21c1
Sequence:CCGGGCAGCGGACTTCAGTTCTATTCTCGAGAATAGAACTGAAGTCCGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013581.3-1098s21c1
Sequence:CCGGATGTGCAATGAAGACATTAAACTCGAGTTTAATGTCTTCATTGCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013581.3-723s21c1
Sequence:CCGGCTGGCCAGAAAGGCGACTATTCTCGAGAATAGTCGCCTTTCTGGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013581
VALIDATED
COG1 MISSION shRNA Lentiviral Transduction Particles
component of oligomeric golgi complex 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000126474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013581.2-1885s1c1
Sequence:CCGGCCTCACCTAAAGCAGTGCATTCTCGAGAATGCACTGCTTTAGGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013581.2-2616s1c1
Sequence:CCGGGCAGCGGACTTCAGTTCTATTCTCGAGAATAGAACTGAAGTCCGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013581.2-1567s1c1
Sequence:CCGGCTGGATTCTAAGCTGAAGGTTCTCGAGAACCTTCAGCTTAGAATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013581.2-588s1c1
Sequence:CCGGCGAAAGCAAGATGCTGCTCAACTCGAGTTGAGCAGCATCTTGCTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013581.2-1676s1c1
Sequence:CCGGCCTTTGATAGATACGCAGATACTCGAGTATCTGCGTATCTATCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013581.3-580s21c1
Sequence:CCGGGCCACTTCCGGTCAACTATTTCTCGAGAAATAGTTGACCGGAAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013581.3-1587s21c1
Sequence:CCGGGATTCTAAGCTGAAGGTTAAACTCGAGTTTAACCTTCAGCTTAGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013581.3-2633s21c1
Sequence:CCGGGCAGCGGACTTCAGTTCTATTCTCGAGAATAGAACTGAAGTCCGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013581.3-1098s21c1
Sequence:CCGGATGTGCAATGAAGACATTAAACTCGAGTTTAATGTCTTCATTGCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013581.3-723s21c1
Sequence:CCGGCTGGCCAGAAAGGCGACTATTCTCGAGAATAGTCGCCTTTCTGGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks