EMAIL THIS PAGE TO A FRIEND

COG2

component of oligomeric golgi complex 2

79 Gene Product Result for
Synonyms: LDLC
UniProtKB ID: Q14746, Q86U99
Gene ID:
Human(22796) Summary: This gene encodes a subunit of the conserved oligomeric Golgi complex that is required for maintaining normal structure and activity of the Golgi complex. The encoded protein specifically interacts with the USO1 vesicle docking protein and may be necessary for normal Golgi ribbon formation and trafficking of Golgi enzymes. Mutations of this gene are associated with abnormal glycosylation within the Golgi apparatus. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Feb 2009]
Mouse(76332) component of oligomeric golgi complex 2
Rat(690961) component of oligomeric golgi complex 2
domestic guinea pig(100724672) component of oligomeric golgi complex 2
naked mole-rat(101717566) component of oligomeric golgi complex 2
sheep(101122408) component of oligomeric golgi complex 2
Domestic Rabbit(100338169) component of oligomeric golgi complex 2
Zebrafish(406663) component of oligomeric golgi complex 2
cow(512213) component of oligomeric golgi complex 2
Horse(100065352) component of oligomeric golgi complex 2
domestic cat(101092052) component of oligomeric golgi complex 2
dog(488978) component of oligomeric golgi complex 2
chicken(421542) component of oligomeric golgi complex 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007357 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007357 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007357 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029746 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029746 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029746 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007357 Rosetta Predictions human pricing
NM_001110494 Rosetta Predictions rat pricing
XM_001076149 Rosetta Predictions rat pricing
XM_001076243 Rosetta Predictions rat pricing
NM_029746 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007357 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00126244 predicted 1471
2 SASI_Hs01_00126245 predicted 2005
3 SASI_Hs01_00126246 predicted 1451
4 SASI_Hs02_00343457 predicted 2027
5 SASI_Hs01_00126247 predicted 2312
6 SASI_Hs02_00343458 predicted 1788
7 SASI_Hs01_00126248 predicted 1289
8 SASI_Hs01_00126249 predicted 858
9 SASI_Hs01_00126250 predicted 825
10 SASI_Hs01_00126251 predicted 690
11 SASI_Hs01_00126252 predicted 2395
12 SASI_Hs01_00126253 predicted 248
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110494 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00251292 predicted 470
2 SASI_Rn02_00251293 predicted 706
3 SASI_Rn02_00251294 predicted 820
4 SASI_Rn02_00251295 predicted 855
5 SASI_Rn02_00251296 predicted 1661
6 SASI_Rn02_00251297 predicted 589
7 SASI_Rn02_00251298 predicted 1403
8 SASI_Rn02_00251299 predicted 1815
9 SASI_Rn02_00251300 predicted 1405
10 SASI_Rn02_00251301 predicted 1331
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076149 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00352221 predicted 489
2 SASI_Rn02_00352222 predicted 724
3 SASI_Rn02_00352223 predicted 840
4 SASI_Rn02_00352224 predicted 879
5 SASI_Rn02_00352225 predicted 1688
6 SASI_Rn02_00352226 predicted 608
7 SASI_Rn02_00352227 predicted 1426
8 SASI_Rn02_00352228 predicted 1837
9 SASI_Rn02_00352229 predicted 1431
10 SASI_Rn02_00352230 predicted 1344
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076243 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00352533 predicted 492
2 SASI_Rn02_00352534 predicted 732
3 SASI_Rn02_00352535 predicted 851
4 SASI_Rn02_00352536 predicted 881
5 SASI_Rn02_00352537 predicted 1687
6 SASI_Rn02_00352538 predicted 617
7 SASI_Rn02_00352539 predicted 1435
8 SASI_Rn02_00352540 predicted 1834
9 SASI_Rn02_00352541 predicted 1436
10 SASI_Rn02_00352542 predicted 1355
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029746 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00044489 predicted 2141
2 SASI_Mm01_00044490 predicted 1634
3 SASI_Mm01_00044491 predicted 1165
4 SASI_Mm01_00044492 predicted 1393
5 SASI_Mm01_00044493 predicted 1432
6 SASI_Mm01_00044494 predicted 1191
7 SASI_Mm01_00044495 predicted 301
8 SASI_Mm01_00044496 predicted 450
9 SASI_Mm01_00044497 predicted 429
10 SASI_Mm01_00044498 predicted 625
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007357
VALIDATED
COG2 MISSION shRNA Bacterial Glycerol Stock
component of oligomeric golgi complex 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000343437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007357.2-810s21c1
Sequence:CCGGAGACGTCTGACGTCGATATAACTCGAGTTATATCGACGTCAGACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007357.2-293s21c1
Sequence:CCGGGACCTGGAGCTCTACTATAAACTCGAGTTTATAGTAGAGCTCCAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343398    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007357.2-2512s21c1
Sequence:CCGGGCGTCTTCTCTCAGCGTATTTCTCGAGAAATACGCTGAGAGAAGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007357.2-1225s21c1
Sequence:CCGGTGGATCACAGGCTAGTGTAAACTCGAGTTTACACTAGCCTGTGATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007357.2-541s21c1
Sequence:CCGGATTGAGGCTTATACAAGTTATCTCGAGATAACTTGTATAAGCCTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007357.1-1206s1c1
Sequence:CCGGCCTGCCTATCACAGCTTCAATCTCGAGATTGAAGCTGTGATAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007357.1-2020s1c1
Sequence:CCGGGCACTCATAAGTACTATGAAACTCGAGTTTCATAGTACTTATGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007357.1-1594s1c1
Sequence:CCGGCGGAAACAAAGCCTGTGGTTTCTCGAGAAACCACAGGCTTTGTTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007357.1-278s1c1
Sequence:CCGGCGAACTCATCAACAAGGATTACTCGAGTAATCCTTGTTGATGAGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007357.1-855s1c1
Sequence:CCGGCCATACATAGACGAGGTGATTCTCGAGAATCACCTCGTCTATGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007357
VALIDATED
COG2 MISSION shRNA shRNA Plasmid DNA
component of oligomeric golgi complex 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000343437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007357.2-810s21c1
Sequence:CCGGAGACGTCTGACGTCGATATAACTCGAGTTATATCGACGTCAGACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007357.2-293s21c1
Sequence:CCGGGACCTGGAGCTCTACTATAAACTCGAGTTTATAGTAGAGCTCCAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343398    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007357.2-2512s21c1
Sequence:CCGGGCGTCTTCTCTCAGCGTATTTCTCGAGAAATACGCTGAGAGAAGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007357.2-1225s21c1
Sequence:CCGGTGGATCACAGGCTAGTGTAAACTCGAGTTTACACTAGCCTGTGATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007357.2-541s21c1
Sequence:CCGGATTGAGGCTTATACAAGTTATCTCGAGATAACTTGTATAAGCCTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007357.1-1206s1c1
Sequence:CCGGCCTGCCTATCACAGCTTCAATCTCGAGATTGAAGCTGTGATAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007357.1-2020s1c1
Sequence:CCGGGCACTCATAAGTACTATGAAACTCGAGTTTCATAGTACTTATGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007357.1-1594s1c1
Sequence:CCGGCGGAAACAAAGCCTGTGGTTTCTCGAGAAACCACAGGCTTTGTTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007357.1-278s1c1
Sequence:CCGGCGAACTCATCAACAAGGATTACTCGAGTAATCCTTGTTGATGAGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007357.1-855s1c1
Sequence:CCGGCCATACATAGACGAGGTGATTCTCGAGAATCACCTCGTCTATGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007357
VALIDATED
COG2 MISSION shRNA Lentiviral Transduction Particles
component of oligomeric golgi complex 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000343437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007357.2-810s21c1
Sequence:CCGGAGACGTCTGACGTCGATATAACTCGAGTTATATCGACGTCAGACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007357.2-293s21c1
Sequence:CCGGGACCTGGAGCTCTACTATAAACTCGAGTTTATAGTAGAGCTCCAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343398    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007357.2-2512s21c1
Sequence:CCGGGCGTCTTCTCTCAGCGTATTTCTCGAGAAATACGCTGAGAGAAGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007357.2-1225s21c1
Sequence:CCGGTGGATCACAGGCTAGTGTAAACTCGAGTTTACACTAGCCTGTGATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007357.2-541s21c1
Sequence:CCGGATTGAGGCTTATACAAGTTATCTCGAGATAACTTGTATAAGCCTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007357.1-1206s1c1
Sequence:CCGGCCTGCCTATCACAGCTTCAATCTCGAGATTGAAGCTGTGATAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007357.1-2020s1c1
Sequence:CCGGGCACTCATAAGTACTATGAAACTCGAGTTTCATAGTACTTATGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007357.1-1594s1c1
Sequence:CCGGCGGAAACAAAGCCTGTGGTTTCTCGAGAAACCACAGGCTTTGTTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007357.1-278s1c1
Sequence:CCGGCGAACTCATCAACAAGGATTACTCGAGTAATCCTTGTTGATGAGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007357.1-855s1c1
Sequence:CCGGCCATACATAGACGAGGTGATTCTCGAGAATCACCTCGTCTATGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029746
VALIDATED
COG2 MISSION shRNA Bacterial Glycerol Stock
component of oligomeric golgi complex 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000302921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029746.2-1076s21c1
Sequence:CCGGCCAGAAATACACTGTGAGCATCTCGAGATGCTCACAGTGTATTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029746.2-573s21c1
Sequence:CCGGGCCACAGAGTTTAACCAGCTTCTCGAGAAGCTGGTTAAACTCTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029746.2-976s21c1
Sequence:CCGGGCTATGATTTCTTGGTGAATTCTCGAGAATTCACCAAGAAATCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029746.2-749s21c1
Sequence:CCGGTACCTATGCCACCATTGATAACTCGAGTTATCAATGGTGGCATAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311222    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029746.2-2546s21c1
Sequence:CCGGACTGGGCAGGATGCACCAATACTCGAGTATTGGTGCATCCTGCCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098895    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029746.2-2327s1c1
Sequence:CCGGCCCACTTATATGGGCCATCTTCTCGAGAAGATGGCCCATATAAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029746.2-1076s1c1
Sequence:CCGGCCAGAAATACACTGTGAGCATCTCGAGATGCTCACAGTGTATTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029746.2-573s1c1
Sequence:CCGGGCCACAGAGTTTAACCAGCTTCTCGAGAAGCTGGTTAAACTCTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029746.2-976s1c1
Sequence:CCGGGCTATGATTTCTTGGTGAATTCTCGAGAATTCACCAAGAAATCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029746.2-1346s1c1
Sequence:CCGGCGATGAGATGTTCCTACCTTTCTCGAGAAAGGTAGGAACATCTCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029746
VALIDATED
COG2 MISSION shRNA shRNA Plasmid DNA
component of oligomeric golgi complex 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000302921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029746.2-1076s21c1
Sequence:CCGGCCAGAAATACACTGTGAGCATCTCGAGATGCTCACAGTGTATTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029746.2-573s21c1
Sequence:CCGGGCCACAGAGTTTAACCAGCTTCTCGAGAAGCTGGTTAAACTCTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029746.2-976s21c1
Sequence:CCGGGCTATGATTTCTTGGTGAATTCTCGAGAATTCACCAAGAAATCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029746.2-749s21c1
Sequence:CCGGTACCTATGCCACCATTGATAACTCGAGTTATCAATGGTGGCATAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311222    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029746.2-2546s21c1
Sequence:CCGGACTGGGCAGGATGCACCAATACTCGAGTATTGGTGCATCCTGCCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098895    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029746.2-2327s1c1
Sequence:CCGGCCCACTTATATGGGCCATCTTCTCGAGAAGATGGCCCATATAAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029746.2-1076s1c1
Sequence:CCGGCCAGAAATACACTGTGAGCATCTCGAGATGCTCACAGTGTATTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029746.2-573s1c1
Sequence:CCGGGCCACAGAGTTTAACCAGCTTCTCGAGAAGCTGGTTAAACTCTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029746.2-976s1c1
Sequence:CCGGGCTATGATTTCTTGGTGAATTCTCGAGAATTCACCAAGAAATCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029746.2-1346s1c1
Sequence:CCGGCGATGAGATGTTCCTACCTTTCTCGAGAAAGGTAGGAACATCTCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029746
VALIDATED
COG2 MISSION shRNA Lentiviral Transduction Particles
component of oligomeric golgi complex 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000302921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029746.2-1076s21c1
Sequence:CCGGCCAGAAATACACTGTGAGCATCTCGAGATGCTCACAGTGTATTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029746.2-573s21c1
Sequence:CCGGGCCACAGAGTTTAACCAGCTTCTCGAGAAGCTGGTTAAACTCTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029746.2-976s21c1
Sequence:CCGGGCTATGATTTCTTGGTGAATTCTCGAGAATTCACCAAGAAATCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029746.2-749s21c1
Sequence:CCGGTACCTATGCCACCATTGATAACTCGAGTTATCAATGGTGGCATAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311222    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029746.2-2546s21c1
Sequence:CCGGACTGGGCAGGATGCACCAATACTCGAGTATTGGTGCATCCTGCCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098895    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029746.2-2327s1c1
Sequence:CCGGCCCACTTATATGGGCCATCTTCTCGAGAAGATGGCCCATATAAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029746.2-1076s1c1
Sequence:CCGGCCAGAAATACACTGTGAGCATCTCGAGATGCTCACAGTGTATTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029746.2-573s1c1
Sequence:CCGGGCCACAGAGTTTAACCAGCTTCTCGAGAAGCTGGTTAAACTCTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029746.2-976s1c1
Sequence:CCGGGCTATGATTTCTTGGTGAATTCTCGAGAATTCACCAAGAAATCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029746.2-1346s1c1
Sequence:CCGGCGATGAGATGTTCCTACCTTTCTCGAGAAAGGTAGGAACATCTCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks