EMAIL THIS PAGE TO A FRIEND

COG3

component of oligomeric golgi complex 3

129 Gene Product Result for
Synonyms: SEC34
UniProtKB ID: Q96JB2, B2RAW5, Q5VT70, Q8IXX4, Q9BZ92
Gene ID:
Human(83548) Summary: This gene encodes a component of the conserved oligomeric Golgi (COG) complex which is composed of eight different subunits and is required for normal Golgi morphology and localization. Defects in the COG complex result in multiple deficiencies in protein glycosylation. The protein encoded by this gene is involved in ER-Golgi transport.[provided by RefSeq, Jun 2011]
Mouse(338337) component of oligomeric golgi complex 3
Rat(361073) component of oligomeric golgi complex 3
Zebrafish(553061) component of oligomeric golgi complex 3
fruit fly(33562) CG3248 gene product from transcript CG3248-RA
chicken(418846) component of oligomeric golgi complex 3
cow(532845) component of oligomeric golgi complex 3
Horse(100050896) component of oligomeric golgi complex 3
domestic cat(101082871) component of oligomeric golgi complex 3
dog(485455) component of oligomeric golgi complex 3
sheep(101103330) component of oligomeric golgi complex 3
Domestic Rabbit(100338741) component of oligomeric golgi complex 3
naked mole-rat(101714130) component of oligomeric golgi complex 3
domestic guinea pig(100734940) component of oligomeric golgi complex 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031431 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031431 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031431 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177381 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177381 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177381 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031431 Rosetta Predictions human pricing
NM_001012157 Rosetta Predictions rat pricing
XM_577450 Rosetta Predictions rat pricing
NM_177381 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031431 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00167807 predicted 1744
2 SASI_Hs01_00167808 predicted 2086
3 SASI_Hs02_00358838 predicted 2402
4 SASI_Hs01_00167809 predicted 1866
5 SASI_Hs01_00167811 predicted 1908
6 SASI_Hs01_00167812 predicted 2381
7 SASI_Hs01_00167813 predicted 2045
8 SASI_Hs01_00167814 predicted 747
9 SASI_Hs02_00358839 predicted 352
10 SASI_Hs02_00358840 predicted 1532
11 SASI_Hs01_00167806 predicted 2135
12 SASI_Hs01_00167810 predicted 1355
13 SASI_Hs01_00167815 predicted 474
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012157 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00091601 predicted 2065
2 SASI_Rn01_00091602 predicted 944
3 SASI_Rn02_00200345 predicted 1889
4 SASI_Rn01_00091603 predicted 2025
5 SASI_Rn01_00091604 predicted 2366
6 SASI_Rn01_00091606 predicted 1312
7 SASI_Rn01_00091607 predicted 750
8 SASI_Rn01_00091608 predicted 1702
9 SASI_Rn01_00091609 predicted 444
10 SASI_Rn01_00091610 predicted 1160
11 SASI_Rn01_00091605 predicted 936
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_577450 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00163247 predicted 2321
2 SASI_Rn01_00163248 predicted 2170
3 SASI_Rn01_00163249 predicted 1053
4 SASI_Rn01_00163250 predicted 1991
5 SASI_Rn01_00163251 predicted 2051
6 SASI_Rn01_00163252 predicted 982
7 SASI_Rn01_00163253 predicted 2132
8 SASI_Rn01_00163254 predicted 1040
9 SASI_Rn01_00163255 predicted 1417
10 SASI_Rn01_00163256 predicted 865
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177381 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00102725 predicted 2035
2 SASI_Mm01_00102726 predicted 918
3 SASI_Mm01_00102727 predicted 1858
4 SASI_Mm01_00102728 predicted 2003
5 SASI_Mm01_00102729 predicted 731
6 SASI_Mm01_00102730 predicted 1013
7 SASI_Mm01_00102731 predicted 905
8 SASI_Mm01_00102732 predicted 2446
9 SASI_Mm01_00102733 predicted 421
10 SASI_Mm01_00102734 predicted 1137
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031431
VALIDATED
COG3 MISSION shRNA Bacterial Glycerol Stock
component of oligomeric golgi complex 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000065228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031431.2-780s1c1
Sequence:CCGGGCCAAGTTAGATGATTGTATACTCGAGTATACAATCATCTAACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_031431.2-1860s1c1
Sequence:CCGGGCCTGCATTCAGTCCTTACTTCTCGAGAAGTAAGGACTGAATGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031431.2-2127s1c1
Sequence:CCGGCCTGAGATAAGAGAACATTATCTCGAGATAATGTTCTCTTATCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031431.2-837s1c1
Sequence:CCGGCCCATATATTTGCTGAAGTTTCTCGAGAAACTTCAGCAAATATATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031431.2-318s1c1
Sequence:CCGGCCCATTGAACTGACTTCAGTACTCGAGTACTGAAGTCAGTTCAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031431.2-515s21c1
Sequence:CCGGGGAGCAGTGTGATGCTATATTCTCGAGAATATAGCATCACACTGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031431.2-2249s21c1
Sequence:CCGGGACAAAGGTTTCAGCGTTAAACTCGAGTTTAACGCTGAAACCTTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416268    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031431.2-2810s21c1
Sequence:CCGGGTGATAACTGCCTCGTTTAAACTCGAGTTTAAACGAGGCAGTTATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031431.2-749s21c1
Sequence:CCGGGGTGAATAGTGACGGATTTATCTCGAGATAAATCCGTCACTATTCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031431
VALIDATED
COG3 MISSION shRNA shRNA Plasmid DNA
component of oligomeric golgi complex 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000065228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031431.2-780s1c1
Sequence:CCGGGCCAAGTTAGATGATTGTATACTCGAGTATACAATCATCTAACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_031431.2-1860s1c1
Sequence:CCGGGCCTGCATTCAGTCCTTACTTCTCGAGAAGTAAGGACTGAATGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031431.2-2127s1c1
Sequence:CCGGCCTGAGATAAGAGAACATTATCTCGAGATAATGTTCTCTTATCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031431.2-837s1c1
Sequence:CCGGCCCATATATTTGCTGAAGTTTCTCGAGAAACTTCAGCAAATATATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031431.2-318s1c1
Sequence:CCGGCCCATTGAACTGACTTCAGTACTCGAGTACTGAAGTCAGTTCAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031431.2-515s21c1
Sequence:CCGGGGAGCAGTGTGATGCTATATTCTCGAGAATATAGCATCACACTGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031431.2-2249s21c1
Sequence:CCGGGACAAAGGTTTCAGCGTTAAACTCGAGTTTAACGCTGAAACCTTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416268    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031431.2-2810s21c1
Sequence:CCGGGTGATAACTGCCTCGTTTAAACTCGAGTTTAAACGAGGCAGTTATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031431.2-749s21c1
Sequence:CCGGGGTGAATAGTGACGGATTTATCTCGAGATAAATCCGTCACTATTCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031431
VALIDATED
COG3 MISSION shRNA Lentiviral Transduction Particles
component of oligomeric golgi complex 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000065228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031431.2-780s1c1
Sequence:CCGGGCCAAGTTAGATGATTGTATACTCGAGTATACAATCATCTAACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_031431.2-1860s1c1
Sequence:CCGGGCCTGCATTCAGTCCTTACTTCTCGAGAAGTAAGGACTGAATGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031431.2-2127s1c1
Sequence:CCGGCCTGAGATAAGAGAACATTATCTCGAGATAATGTTCTCTTATCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031431.2-837s1c1
Sequence:CCGGCCCATATATTTGCTGAAGTTTCTCGAGAAACTTCAGCAAATATATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031431.2-318s1c1
Sequence:CCGGCCCATTGAACTGACTTCAGTACTCGAGTACTGAAGTCAGTTCAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031431.2-515s21c1
Sequence:CCGGGGAGCAGTGTGATGCTATATTCTCGAGAATATAGCATCACACTGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031431.2-2249s21c1
Sequence:CCGGGACAAAGGTTTCAGCGTTAAACTCGAGTTTAACGCTGAAACCTTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416268    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031431.2-2810s21c1
Sequence:CCGGGTGATAACTGCCTCGTTTAAACTCGAGTTTAAACGAGGCAGTTATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031431.2-749s21c1
Sequence:CCGGGGTGAATAGTGACGGATTTATCTCGAGATAAATCCGTCACTATTCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177381
COG3 MISSION shRNA Bacterial Glycerol Stock
component of oligomeric golgi complex 3
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000175521    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177381.2-978s1c1
Sequence:CCGGCCCTAAAGTCAGAACTCTAATCTCGAGATTAGAGTTCTGACTTTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175384    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177381.2-4057s1c1
Sequence:CCGGCCAGTTTGTTTGCTGAATGAACTCGAGTTCATTCAGCAAACAAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175082    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177381.2-745s1c1
Sequence:CCGGGCCAAGTTAGATGATTGTATACTCGAGTATACAATCATCTAACTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177381.3-655s21c1
Sequence:CCGGTAATGAGTTGGAGACGATTAACTCGAGTTAATCGTCTCCAACTCATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177381.3-2009s21c1
Sequence:CCGGCCTATGACTGTTCCACGATTTCTCGAGAAATCGTGGAACAGTCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177381.3-923s21c1
Sequence:CCGGGACAATGCCTTCACACTATTTCTCGAGAAATAGTGTGAAGGCATTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216960    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177381.3-2009s1c1
Sequence:CCGGCCTATGACTGTTCCACGATTTCTCGAGAAATCGTGGAACAGTCATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248283    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177381.3-3707s21c1
Sequence:CCGGGTTGCTTGGTAGAGCATATTACTCGAGTAATATGCTCTACCAAGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177381.3-1186s21c1
Sequence:CCGGCCAAGATGAGCACCAACTTTACTCGAGTAAAGTTGGTGCTCATCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177381
COG3 MISSION shRNA shRNA Plasmid DNA
component of oligomeric golgi complex 3
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000175521    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177381.2-978s1c1
Sequence:CCGGCCCTAAAGTCAGAACTCTAATCTCGAGATTAGAGTTCTGACTTTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175384    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177381.2-4057s1c1
Sequence:CCGGCCAGTTTGTTTGCTGAATGAACTCGAGTTCATTCAGCAAACAAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175082    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177381.2-745s1c1
Sequence:CCGGGCCAAGTTAGATGATTGTATACTCGAGTATACAATCATCTAACTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177381.3-655s21c1
Sequence:CCGGTAATGAGTTGGAGACGATTAACTCGAGTTAATCGTCTCCAACTCATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177381.3-2009s21c1
Sequence:CCGGCCTATGACTGTTCCACGATTTCTCGAGAAATCGTGGAACAGTCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177381.3-923s21c1
Sequence:CCGGGACAATGCCTTCACACTATTTCTCGAGAAATAGTGTGAAGGCATTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216960    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177381.3-2009s1c1
Sequence:CCGGCCTATGACTGTTCCACGATTTCTCGAGAAATCGTGGAACAGTCATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248283    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177381.3-3707s21c1
Sequence:CCGGGTTGCTTGGTAGAGCATATTACTCGAGTAATATGCTCTACCAAGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177381.3-1186s21c1
Sequence:CCGGCCAAGATGAGCACCAACTTTACTCGAGTAAAGTTGGTGCTCATCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177381
COG3 MISSION shRNA Lentiviral Transduction Particles
component of oligomeric golgi complex 3
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000175521    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177381.2-978s1c1
Sequence:CCGGCCCTAAAGTCAGAACTCTAATCTCGAGATTAGAGTTCTGACTTTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175384    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177381.2-4057s1c1
Sequence:CCGGCCAGTTTGTTTGCTGAATGAACTCGAGTTCATTCAGCAAACAAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175082    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177381.2-745s1c1
Sequence:CCGGGCCAAGTTAGATGATTGTATACTCGAGTATACAATCATCTAACTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177381.3-655s21c1
Sequence:CCGGTAATGAGTTGGAGACGATTAACTCGAGTTAATCGTCTCCAACTCATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177381.3-2009s21c1
Sequence:CCGGCCTATGACTGTTCCACGATTTCTCGAGAAATCGTGGAACAGTCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177381.3-923s21c1
Sequence:CCGGGACAATGCCTTCACACTATTTCTCGAGAAATAGTGTGAAGGCATTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216960    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177381.3-2009s1c1
Sequence:CCGGCCTATGACTGTTCCACGATTTCTCGAGAAATCGTGGAACAGTCATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248283    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177381.3-3707s21c1
Sequence:CCGGGTTGCTTGGTAGAGCATATTACTCGAGTAATATGCTCTACCAAGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177381.3-1186s21c1
Sequence:CCGGCCAAGATGAGCACCAACTTTACTCGAGTAAAGTTGGTGCTCATCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks