EMAIL THIS PAGE TO A FRIEND

COG4

component of oligomeric golgi complex 4

55 Gene Product Result for
Synonyms: CDG2J COD1
Gene ID:
Human(25839) Summary: The protein encoded by this gene is a component of an oligomeric protein complex involved in the structure and function of the Golgi apparatus. Defects in this gene may be a cause of congenital disorder of glycosylation type IIj. Two transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Aug 2010]
Mouse(102339) component of oligomeric golgi complex 4
Rat(361407) component of oligomeric golgi complex 4
domestic guinea pig(100722825) component of oligomeric golgi complex 4
naked mole-rat(101722634) component of oligomeric golgi complex 4
sheep(101113782) component of oligomeric golgi complex 4
Zebrafish(569049) component of oligomeric golgi complex 4
cow(533007) component of oligomeric golgi complex 4
Horse(100054801) component of oligomeric golgi complex 4
domestic cat(101086615) component of oligomeric golgi complex 4
dog(489716) component of oligomeric golgi complex 4
chicken(415681) component of oligomeric golgi complex 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015386 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015386 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015386 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133973 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133973 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133973 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015386 Rosetta Predictions human pricing
NM_001108449 Rosetta Predictions rat pricing
NM_133973 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015386 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00171069 predicted 377
2 SASI_Hs01_00171070 predicted 697
3 SASI_Hs01_00171071 predicted 342
4 SASI_Hs01_00171073 predicted 1031
5 SASI_Hs01_00171074 predicted 894
6 SASI_Hs01_00171075 predicted 819
7 SASI_Hs01_00171076 predicted 1374
8 SASI_Hs01_00171078 predicted 927
9 SASI_Hs02_00347740 predicted 370
10 SASI_Hs02_00347741 predicted 268
11 SASI_Hs01_00171072 predicted 865
12 SASI_Hs01_00171077 predicted 1003
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108449 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00238749 predicted 1258
2 SASI_Rn02_00238750 predicted 378
3 SASI_Rn02_00238751 predicted 721
4 SASI_Rn02_00238752 predicted 1678
5 SASI_Rn02_00238753 predicted 227
6 SASI_Rn02_00238754 predicted 1922
7 SASI_Rn02_00238755 predicted 542
8 SASI_Rn02_00238756 predicted 2142
9 SASI_Rn02_00238757 predicted 1412
10 SASI_Rn02_00238758 predicted 311
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133973 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00339097 predicted 931
2 SASI_Mm01_00051519 predicted 387
3 SASI_Mm01_00051520 predicted 1484
4 SASI_Mm01_00051521 predicted 724
5 SASI_Mm01_00051522 predicted 1857
6 SASI_Mm01_00051523 predicted 236
7 SASI_Mm01_00051524 predicted 1931
8 SASI_Mm01_00051526 predicted 309
9 SASI_Mm01_00051527 predicted 548
10 SASI_Mm01_00051528 predicted 1268
11 SASI_Mm01_00051525 predicted 1404
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015386
COG4 MISSION shRNA Bacterial Glycerol Stock
component of oligomeric golgi complex 4
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000443798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015386.2-2247s21c1
Sequence:CCGGGTGACCGAGATCCTCGATTACCTCGAGGTAATCGAGGATCTCGGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015386.2-821s21c1
Sequence:CCGGCATCTTTGCAGATACACTTACCTCGAGGTAAGTGTATCTGCAAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180098    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015386.1-1941s1c1
Sequence:CCGGCCCTTGGGTACAACAGTTCATCTCGAGATGAACTGTTGTACCCAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179190    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015386.1-1104s1c1
Sequence:CCGGGCTATACTTACGCTTCCTCAACTCGAGTTGAGGAAGCGTAAGTATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015386.1-1242s1c1
Sequence:CCGGGCAGGAGCTAATTGGCTTATACTCGAGTATAAGCCAATTAGCTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015386.1-1470s1c1
Sequence:CCGGCAGGGATGTTCTGTGTAATAACTCGAGTTATTACACAGAACATCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015386.1-209s1c1
Sequence:CCGGCCATTGAAAGTAAGATGGTCACTCGAGTGACCATCTTACTTTCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015386.1-1794s1c1
Sequence:CCGGCAACAAATTCCGAGACCTCTTCTCGAGAAGAGGTCTCGGAATTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015386
COG4 MISSION shRNA shRNA Plasmid DNA
component of oligomeric golgi complex 4
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000443798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015386.2-2247s21c1
Sequence:CCGGGTGACCGAGATCCTCGATTACCTCGAGGTAATCGAGGATCTCGGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015386.2-821s21c1
Sequence:CCGGCATCTTTGCAGATACACTTACCTCGAGGTAAGTGTATCTGCAAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180098    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015386.1-1941s1c1
Sequence:CCGGCCCTTGGGTACAACAGTTCATCTCGAGATGAACTGTTGTACCCAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179190    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015386.1-1104s1c1
Sequence:CCGGGCTATACTTACGCTTCCTCAACTCGAGTTGAGGAAGCGTAAGTATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015386.1-1242s1c1
Sequence:CCGGGCAGGAGCTAATTGGCTTATACTCGAGTATAAGCCAATTAGCTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015386.1-1470s1c1
Sequence:CCGGCAGGGATGTTCTGTGTAATAACTCGAGTTATTACACAGAACATCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015386.1-209s1c1
Sequence:CCGGCCATTGAAAGTAAGATGGTCACTCGAGTGACCATCTTACTTTCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015386.1-1794s1c1
Sequence:CCGGCAACAAATTCCGAGACCTCTTCTCGAGAAGAGGTCTCGGAATTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015386
COG4 MISSION shRNA Lentiviral Transduction Particles
component of oligomeric golgi complex 4
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000443798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015386.2-2247s21c1
Sequence:CCGGGTGACCGAGATCCTCGATTACCTCGAGGTAATCGAGGATCTCGGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015386.2-821s21c1
Sequence:CCGGCATCTTTGCAGATACACTTACCTCGAGGTAAGTGTATCTGCAAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180098    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015386.1-1941s1c1
Sequence:CCGGCCCTTGGGTACAACAGTTCATCTCGAGATGAACTGTTGTACCCAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179190    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015386.1-1104s1c1
Sequence:CCGGGCTATACTTACGCTTCCTCAACTCGAGTTGAGGAAGCGTAAGTATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015386.1-1242s1c1
Sequence:CCGGGCAGGAGCTAATTGGCTTATACTCGAGTATAAGCCAATTAGCTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015386.1-1470s1c1
Sequence:CCGGCAGGGATGTTCTGTGTAATAACTCGAGTTATTACACAGAACATCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015386.1-209s1c1
Sequence:CCGGCCATTGAAAGTAAGATGGTCACTCGAGTGACCATCTTACTTTCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015386.1-1794s1c1
Sequence:CCGGCAACAAATTCCGAGACCTCTTCTCGAGAAGAGGTCTCGGAATTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133973
COG4 MISSION shRNA Bacterial Glycerol Stock
component of oligomeric golgi complex 4
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000316117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133973.2-720s21c1
Sequence:CCGGCCTGAGCAAGTTCTCGGAATACTCGAGTATTCCGAGAACTTGCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133973.2-1117s21c1
Sequence:CCGGGCGCGAAGTGAACTGTACTTACTCGAGTAAGTACAGTTCACTTCGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349158    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133973.2-2400s21c1
Sequence:CCGGGCCAGACTTCAGGACCTGTTTCTCGAGAAACAGGTCCTGAAGTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133973.2-2248s21c1
Sequence:CCGGCGGGTGACTGAGATACTAGATCTCGAGATCTAGTATCTCAGTCACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125504    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133973.1-2377s1c1
Sequence:CCGGGCCAGACTTCAGGACCTGTTTCTCGAGAAACAGGTCCTGAAGTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133973.1-1094s1c1
Sequence:CCGGGCGCGAAGTGAACTGTACTTACTCGAGTAAGTACAGTTCACTTCGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133973.1-697s1c1
Sequence:CCGGCCTGAGCAAGTTCTCGGAATACTCGAGTATTCCGAGAACTTGCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133973.1-896s1c1
Sequence:CCGGCGACTCTTTACCCTGATCAAACTCGAGTTTGATCAGGGTAAAGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133973.1-2225s1c1
Sequence:CCGGCGGGTGACTGAGATACTAGATCTCGAGATCTAGTATCTCAGTCACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133973
COG4 MISSION shRNA shRNA Plasmid DNA
component of oligomeric golgi complex 4
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000316117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133973.2-720s21c1
Sequence:CCGGCCTGAGCAAGTTCTCGGAATACTCGAGTATTCCGAGAACTTGCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133973.2-1117s21c1
Sequence:CCGGGCGCGAAGTGAACTGTACTTACTCGAGTAAGTACAGTTCACTTCGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349158    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133973.2-2400s21c1
Sequence:CCGGGCCAGACTTCAGGACCTGTTTCTCGAGAAACAGGTCCTGAAGTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133973.2-2248s21c1
Sequence:CCGGCGGGTGACTGAGATACTAGATCTCGAGATCTAGTATCTCAGTCACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125504    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133973.1-2377s1c1
Sequence:CCGGGCCAGACTTCAGGACCTGTTTCTCGAGAAACAGGTCCTGAAGTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133973.1-1094s1c1
Sequence:CCGGGCGCGAAGTGAACTGTACTTACTCGAGTAAGTACAGTTCACTTCGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133973.1-697s1c1
Sequence:CCGGCCTGAGCAAGTTCTCGGAATACTCGAGTATTCCGAGAACTTGCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133973.1-896s1c1
Sequence:CCGGCGACTCTTTACCCTGATCAAACTCGAGTTTGATCAGGGTAAAGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133973.1-2225s1c1
Sequence:CCGGCGGGTGACTGAGATACTAGATCTCGAGATCTAGTATCTCAGTCACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133973
COG4 MISSION shRNA Lentiviral Transduction Particles
component of oligomeric golgi complex 4
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000316117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133973.2-720s21c1
Sequence:CCGGCCTGAGCAAGTTCTCGGAATACTCGAGTATTCCGAGAACTTGCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133973.2-1117s21c1
Sequence:CCGGGCGCGAAGTGAACTGTACTTACTCGAGTAAGTACAGTTCACTTCGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349158    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133973.2-2400s21c1
Sequence:CCGGGCCAGACTTCAGGACCTGTTTCTCGAGAAACAGGTCCTGAAGTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133973.2-2248s21c1
Sequence:CCGGCGGGTGACTGAGATACTAGATCTCGAGATCTAGTATCTCAGTCACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125504    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133973.1-2377s1c1
Sequence:CCGGGCCAGACTTCAGGACCTGTTTCTCGAGAAACAGGTCCTGAAGTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133973.1-1094s1c1
Sequence:CCGGGCGCGAAGTGAACTGTACTTACTCGAGTAAGTACAGTTCACTTCGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133973.1-697s1c1
Sequence:CCGGCCTGAGCAAGTTCTCGGAATACTCGAGTATTCCGAGAACTTGCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133973.1-896s1c1
Sequence:CCGGCGACTCTTTACCCTGATCAAACTCGAGTTTGATCAGGGTAAAGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133973.1-2225s1c1
Sequence:CCGGCGGGTGACTGAGATACTAGATCTCGAGATCTAGTATCTCAGTCACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks