EMAIL THIS PAGE TO A FRIEND

COG5

component of oligomeric golgi complex 5

55 Gene Product Result for
Synonyms: CDG2I GOLTC1 GTC90
UniProtKB ID: Q9UP83, A4D0R6, A4D0R7, O14555, O95008, Q6NUL5
Gene ID:
Human(10466) Summary: The protein encoded by this gene is one of eight proteins (Cog1-8) which form a Golgi-localized complex (COG) required for normal Golgi morphology and function. The encoded protein is organized with conserved oligomeric Golgi complex components 6, 7 and 8 into a sub-complex referred to as lobe B. Alternative splicing results in multiple transcript variants. Mutations in this gene result in congenital disorder of glycosylation type 2I.[provided by RefSeq, Jan 2011]
Mouse(238123) component of oligomeric golgi complex 5
Rat(298945) component of oligomeric golgi complex 5
Zebrafish(567886) component of oligomeric golgi complex 5
dog(483265) component of oligomeric golgi complex 5
cow(100125306) component of oligomeric golgi complex 5
Horse(100060129) component of oligomeric golgi complex 5
domestic cat(101080878) component of oligomeric golgi complex 5
chicken(417704) component of oligomeric golgi complex 5
sheep(101106255) component of oligomeric golgi complex 5
naked mole-rat(101705464) component of oligomeric golgi complex 5
domestic guinea pig(100718950) component of oligomeric golgi complex 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006348 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006348 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006348 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006348 Rosetta Predictions human pricing
NM_181733 Rosetta Predictions human pricing
XM_216684 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006348 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00341385 predicted 2667
2 SASI_Hs01_00202417 predicted 858
3 SASI_Hs01_00202418 predicted 1341
4 SASI_Hs01_00202419 predicted 1310
5 SASI_Hs01_00202420 predicted 270
6 SASI_Hs02_00341386 predicted 695
7 SASI_Hs01_00202421 predicted 2132
8 SASI_Hs01_00202425 predicted 1533
9 SASI_Hs02_00341387 predicted 1378
10 SASI_Hs02_00341388 predicted 888
11 SASI_Hs01_00202416 predicted 392
12 SASI_Hs01_00202422 predicted 1121
13 SASI_Hs01_00202423 predicted 2263
14 SASI_Hs01_00202424 predicted 2256
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181733 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00370341 predicted 2606
2 SASI_Hs01_00073593 predicted 853
3 SASI_Hs01_00073594 predicted 1340
4 SASI_Hs01_00073595 predicted 1308
5 SASI_Hs01_00073596 predicted 270
6 SASI_Hs02_00370342 predicted 691
7 SASI_Hs01_00073597 predicted 2066
8 SASI_Hs01_00073601 predicted 1524
9 SASI_Hs02_00370343 predicted 1372
10 SASI_Hs02_00370344 predicted 893
11 SASI_Hs01_00073592 predicted 399
12 SASI_Hs01_00073598 predicted 1120
13 SASI_Hs01_00073599 predicted 2200
14 SASI_Hs01_00073600 predicted 2201
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_216684 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00147008 predicted 387
2 SASI_Rn01_00147009 predicted 320
3 SASI_Rn01_00147010 predicted 234
4 SASI_Rn01_00147011 predicted 209
5 SASI_Rn01_00147012 predicted 311
6 SASI_Rn01_00147013 predicted 221
7 SASI_Rn01_00147014 predicted 259
8 SASI_Rn01_00147015 predicted 344
9 SASI_Rn01_00147016 predicted 257
10 SASI_Rn01_00147017 predicted 240
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006348
COG5 MISSION shRNA Bacterial Glycerol Stock
component of oligomeric golgi complex 5
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006348.2-1117s1c1
Sequence:CCGGGCCAAGAAGAGAGATCCTGTTCTCGAGAACAGGATCTCTCTTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006348.2-1468s1c1
Sequence:CCGGGCTTTGAAAGACTCACTACAACTCGAGTTGTAGTGAGTCTTTCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006348.2-1637s1c1
Sequence:CCGGCTGTTGATACAAACCTCACATCTCGAGATGTGAGGTTTGTATCAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151694    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006348.2-391s1c1
Sequence:CCGGCATGAAGATTTACTGGCACAACTCGAGTTGTGCCAGTAAATCTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151986    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006348.2-2673s1c1
Sequence:CCGGCCATTCATAGTTGGCAGTTAACTCGAGTTAACTGCCAACTATGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006348.2-2069s1c1
Sequence:CCGGCCAGAGTTATGAGTGACTATTCTCGAGAATAGTCACTCATAACTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152308    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006348.2-2578s1c1
Sequence:CCGGCCAGTTTATCCCATAATGGTTCTCGAGAACCATTATGGGATAAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006348.3-1333s21c1
Sequence:CCGGGGAACTTTGAAGGATACTATTCTCGAGAATAGTATCCTTCAAAGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413640    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006348.3-3211s21c1
Sequence:CCGGGTAATTGATTGTTCGGTATTTCTCGAGAAATACCGAACAATCAATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006348.3-1045s21c1
Sequence:CCGGGATTTGCTTCGGAGGATTATTCTCGAGAATAATCCTCCGAAGCAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006348.3-3048s21c1
Sequence:CCGGTGCACCAGTTTATCCCATAATCTCGAGATTATGGGATAAACTGGTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006348
COG5 MISSION shRNA shRNA Plasmid DNA
component of oligomeric golgi complex 5
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006348.2-1117s1c1
Sequence:CCGGGCCAAGAAGAGAGATCCTGTTCTCGAGAACAGGATCTCTCTTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006348.2-1468s1c1
Sequence:CCGGGCTTTGAAAGACTCACTACAACTCGAGTTGTAGTGAGTCTTTCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006348.2-1637s1c1
Sequence:CCGGCTGTTGATACAAACCTCACATCTCGAGATGTGAGGTTTGTATCAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151694    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006348.2-391s1c1
Sequence:CCGGCATGAAGATTTACTGGCACAACTCGAGTTGTGCCAGTAAATCTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151986    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006348.2-2673s1c1
Sequence:CCGGCCATTCATAGTTGGCAGTTAACTCGAGTTAACTGCCAACTATGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006348.2-2069s1c1
Sequence:CCGGCCAGAGTTATGAGTGACTATTCTCGAGAATAGTCACTCATAACTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152308    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006348.2-2578s1c1
Sequence:CCGGCCAGTTTATCCCATAATGGTTCTCGAGAACCATTATGGGATAAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006348.3-1333s21c1
Sequence:CCGGGGAACTTTGAAGGATACTATTCTCGAGAATAGTATCCTTCAAAGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413640    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006348.3-3211s21c1
Sequence:CCGGGTAATTGATTGTTCGGTATTTCTCGAGAAATACCGAACAATCAATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006348.3-1045s21c1
Sequence:CCGGGATTTGCTTCGGAGGATTATTCTCGAGAATAATCCTCCGAAGCAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006348.3-3048s21c1
Sequence:CCGGTGCACCAGTTTATCCCATAATCTCGAGATTATGGGATAAACTGGTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006348
COG5 MISSION shRNA Lentiviral Transduction Particles
component of oligomeric golgi complex 5
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006348.2-1117s1c1
Sequence:CCGGGCCAAGAAGAGAGATCCTGTTCTCGAGAACAGGATCTCTCTTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006348.2-1468s1c1
Sequence:CCGGGCTTTGAAAGACTCACTACAACTCGAGTTGTAGTGAGTCTTTCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006348.2-1637s1c1
Sequence:CCGGCTGTTGATACAAACCTCACATCTCGAGATGTGAGGTTTGTATCAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151694    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006348.2-391s1c1
Sequence:CCGGCATGAAGATTTACTGGCACAACTCGAGTTGTGCCAGTAAATCTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151986    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006348.2-2673s1c1
Sequence:CCGGCCATTCATAGTTGGCAGTTAACTCGAGTTAACTGCCAACTATGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006348.2-2069s1c1
Sequence:CCGGCCAGAGTTATGAGTGACTATTCTCGAGAATAGTCACTCATAACTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152308    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006348.2-2578s1c1
Sequence:CCGGCCAGTTTATCCCATAATGGTTCTCGAGAACCATTATGGGATAAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006348.3-1333s21c1
Sequence:CCGGGGAACTTTGAAGGATACTATTCTCGAGAATAGTATCCTTCAAAGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413640    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006348.3-3211s21c1
Sequence:CCGGGTAATTGATTGTTCGGTATTTCTCGAGAAATACCGAACAATCAATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006348.3-1045s21c1
Sequence:CCGGGATTTGCTTCGGAGGATTATTCTCGAGAATAATCCTCCGAAGCAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006348.3-3048s21c1
Sequence:CCGGTGCACCAGTTTATCCCATAATCTCGAGATTATGGGATAAACTGGTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks