EMAIL THIS PAGE TO A FRIEND

COG6

component of oligomeric golgi complex 6

74 Gene Product Result for
Synonyms: CDG2L COD2 SHNS
UniProtKB ID: Q9Y2V7, Q5T0U1, Q6AI19, Q86V49, Q9ULT5
Gene ID:
Human(57511) Summary: This gene encodes a subunit of the conserved oligomeric Golgi complex that is required for maintaining normal structure and activity of the Golgi apparatus. The encoded protein is organized with conserved oligomeric Golgi complex components 5, 7 and 8 into a sub-complex referred to as lobe B. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Feb 2009]
Mouse(67542) component of oligomeric golgi complex 6
Rat(310411) component of oligomeric golgi complex 6
domestic guinea pig(100729760) component of oligomeric golgi complex 6
naked mole-rat(101706590) component of oligomeric golgi complex 6
sheep(101122530) component of oligomeric golgi complex 6
Zebrafish(393290) component of oligomeric golgi complex 6
cow(509305) component of oligomeric golgi complex 6
Horse(100050872) component of oligomeric golgi complex 6
domestic cat(101090072) component of oligomeric golgi complex 6
dog(477296) component of oligomeric golgi complex 6
chicken(418888) component of oligomeric golgi complex 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020751 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020751 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020751 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026225 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026225 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026225 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020751 Rosetta Predictions human pricing
NM_001004262 Rosetta Predictions rat pricing
NM_026225 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020751 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00211269 predicted 947
2 SASI_Hs01_00211270 predicted 1073
3 SASI_Hs01_00211271 predicted 1836
4 SASI_Hs02_00353869 predicted 1244
5 SASI_Hs01_00211272 predicted 1082
6 SASI_Hs01_00211273 predicted 368
7 SASI_Hs02_00353870 predicted 294
8 SASI_Hs01_00211276 predicted 1749
9 SASI_Hs02_00353871 predicted 1708
10 SASI_Hs02_00353872 predicted 1694
11 SASI_Hs01_00211274 predicted 1511
12 SASI_Hs01_00211275 predicted 936
13 SASI_Hs01_00211277 predicted 727
14 SASI_Hs01_00211278 predicted 770
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004262 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00115684 predicted 1695
2 SASI_Rn01_00115685 predicted 1209
3 SASI_Rn01_00115686 predicted 786
4 SASI_Rn01_00115687 predicted 1037
5 SASI_Rn02_00198282 predicted 1188
6 SASI_Rn01_00115688 predicted 880
7 SASI_Rn01_00115689 predicted 1631
8 SASI_Rn01_00115690 predicted 1251
9 SASI_Rn01_00115691 predicted 1662
10 SASI_Rn01_00115692 predicted 994
11 SASI_Rn01_00115693 predicted 1829
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026225 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00129582 predicted 1362
2 SASI_Mm02_00329902 predicted 1847
3 SASI_Mm01_00129583 predicted 432
4 SASI_Mm01_00129584 predicted 1059
5 SASI_Mm01_00129585 predicted 1667
6 SASI_Mm01_00129586 predicted 1015
7 SASI_Mm01_00129587 predicted 745
8 SASI_Mm01_00129588 predicted 1089
9 SASI_Mm02_00329903 predicted 908
10 SASI_Mm01_00129590 predicted 1685
11 SASI_Mm01_00129589 predicted 1060
12 SASI_Mm01_00129591 predicted 814
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020751
VALIDATED
COG6 MISSION shRNA Bacterial Glycerol Stock
component of oligomeric golgi complex 6
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000319255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020751.2-326s21c1
Sequence:CCGGCGTGGAGATATTGAACGTAAACTCGAGTTTACGTTCAATATCTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020751.2-1816s21c1
Sequence:CCGGCCTAGATTCTGTGACACTGAACTCGAGTTCAGTGTCACAGAATCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020751.2-1253s21c1
Sequence:CCGGCACCATACAATCAGTGGTATTCTCGAGAATACCACTGATTGTATGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020751.2-1460s21c1
Sequence:CCGGGCATCTCACGATTCTTCAGTTCTCGAGAACTGAAGAATCGTGAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020751.1-1203s1c1
Sequence:CCGGCACCATACAATCAGTGGTATTCTCGAGAATACCACTGATTGTATGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020751.1-276s1c1
Sequence:CCGGCGTGGAGATATTGAACGTAAACTCGAGTTTACGTTCAATATCTCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020751.1-1766s1c1
Sequence:CCGGCCTAGATTCTGTGACACTGAACTCGAGTTCAGTGTCACAGAATCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_020751.1-1410s1c1
Sequence:CCGGGCATCTCACGATTCTTCAGTTCTCGAGAACTGAAGAATCGTGAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139234    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020751.1-1761s1c1
Sequence:CCGGCCCAACCTAGATTCTGTGACACTCGAGTGTCACAGAATCTAGGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140782    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020751.1-253s1c1
Sequence:CCGGGTCTGCGGACTCGAAGAAATTCTCGAGAATTTCTTCGAGTCCGCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122418    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020751.1-2579s1c1
Sequence:CCGGGCAGTGAATCTCCTTTCTGTTCTCGAGAACAGAAAGGAGATTCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020751.1-669s1c1
Sequence:CCGGGCAGGTTTAGAAATTATGGAACTCGAGTTCCATAATTTCTAAACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020751
VALIDATED
COG6 MISSION shRNA shRNA Plasmid DNA
component of oligomeric golgi complex 6
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000319255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020751.2-326s21c1
Sequence:CCGGCGTGGAGATATTGAACGTAAACTCGAGTTTACGTTCAATATCTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020751.2-1816s21c1
Sequence:CCGGCCTAGATTCTGTGACACTGAACTCGAGTTCAGTGTCACAGAATCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020751.2-1253s21c1
Sequence:CCGGCACCATACAATCAGTGGTATTCTCGAGAATACCACTGATTGTATGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020751.2-1460s21c1
Sequence:CCGGGCATCTCACGATTCTTCAGTTCTCGAGAACTGAAGAATCGTGAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020751.1-1203s1c1
Sequence:CCGGCACCATACAATCAGTGGTATTCTCGAGAATACCACTGATTGTATGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020751.1-276s1c1
Sequence:CCGGCGTGGAGATATTGAACGTAAACTCGAGTTTACGTTCAATATCTCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020751.1-1766s1c1
Sequence:CCGGCCTAGATTCTGTGACACTGAACTCGAGTTCAGTGTCACAGAATCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_020751.1-1410s1c1
Sequence:CCGGGCATCTCACGATTCTTCAGTTCTCGAGAACTGAAGAATCGTGAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139234    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020751.1-1761s1c1
Sequence:CCGGCCCAACCTAGATTCTGTGACACTCGAGTGTCACAGAATCTAGGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140782    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020751.1-253s1c1
Sequence:CCGGGTCTGCGGACTCGAAGAAATTCTCGAGAATTTCTTCGAGTCCGCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122418    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020751.1-2579s1c1
Sequence:CCGGGCAGTGAATCTCCTTTCTGTTCTCGAGAACAGAAAGGAGATTCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020751.1-669s1c1
Sequence:CCGGGCAGGTTTAGAAATTATGGAACTCGAGTTCCATAATTTCTAAACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020751
VALIDATED
COG6 MISSION shRNA Lentiviral Transduction Particles
component of oligomeric golgi complex 6
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000319255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020751.2-326s21c1
Sequence:CCGGCGTGGAGATATTGAACGTAAACTCGAGTTTACGTTCAATATCTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020751.2-1816s21c1
Sequence:CCGGCCTAGATTCTGTGACACTGAACTCGAGTTCAGTGTCACAGAATCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020751.2-1253s21c1
Sequence:CCGGCACCATACAATCAGTGGTATTCTCGAGAATACCACTGATTGTATGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020751.2-1460s21c1
Sequence:CCGGGCATCTCACGATTCTTCAGTTCTCGAGAACTGAAGAATCGTGAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020751.1-1203s1c1
Sequence:CCGGCACCATACAATCAGTGGTATTCTCGAGAATACCACTGATTGTATGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020751.1-276s1c1
Sequence:CCGGCGTGGAGATATTGAACGTAAACTCGAGTTTACGTTCAATATCTCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020751.1-1766s1c1
Sequence:CCGGCCTAGATTCTGTGACACTGAACTCGAGTTCAGTGTCACAGAATCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_020751.1-1410s1c1
Sequence:CCGGGCATCTCACGATTCTTCAGTTCTCGAGAACTGAAGAATCGTGAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139234    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020751.1-1761s1c1
Sequence:CCGGCCCAACCTAGATTCTGTGACACTCGAGTGTCACAGAATCTAGGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140782    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020751.1-253s1c1
Sequence:CCGGGTCTGCGGACTCGAAGAAATTCTCGAGAATTTCTTCGAGTCCGCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122418    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020751.1-2579s1c1
Sequence:CCGGGCAGTGAATCTCCTTTCTGTTCTCGAGAACAGAAAGGAGATTCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020751.1-669s1c1
Sequence:CCGGGCAGGTTTAGAAATTATGGAACTCGAGTTCCATAATTTCTAAACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026225
VALIDATED
COG6 MISSION shRNA Bacterial Glycerol Stock
component of oligomeric golgi complex 6
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000279375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026225.3-861s21c1
Sequence:CCGGGTGGGTTTATTGATGCTCTTACTCGAGTAAGAGCATCAATAAACCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026225.3-1845s21c1
Sequence:CCGGCAGTGAAGGAGCAGATTATAACTCGAGTTATAATCTGCTCCTTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026225.3-1277s21c1
Sequence:CCGGTTGAGTCTCCATGCGAATAAACTCGAGTTTATTCGCATGGAGACTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279378    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026225.3-2114s21c1
Sequence:CCGGATGCGGTTGTAGGTCAATTTCCTCGAGGAAATTGACCTACAACCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026225.3-1585s21c1
Sequence:CCGGGCGCCTAGAAATGCTTCAGTTCTCGAGAACTGAAGCATTTCTAGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000202304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026225.1-1591s1c1
Sequence:CCGGGCGCCTAGAAATGCTTCAGTTCTCGAGAACTGAAGCATTTCTAGGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026225.1-917s1c1
Sequence:CCGGCCCATTGAAATGCACTCCCATCTCGAGATGGGAGTGCATTTCAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026225.1-245s1c1
Sequence:CCGGCGAAGAAATTTACGTGGTGATCTCGAGATCACCACGTAAATTTCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026225.1-867s1c1
Sequence:CCGGGTGGGTTTATTGATGCTCTTACTCGAGTAAGAGCATCAATAAACCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026225
VALIDATED
COG6 MISSION shRNA shRNA Plasmid DNA
component of oligomeric golgi complex 6
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000279375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026225.3-861s21c1
Sequence:CCGGGTGGGTTTATTGATGCTCTTACTCGAGTAAGAGCATCAATAAACCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026225.3-1845s21c1
Sequence:CCGGCAGTGAAGGAGCAGATTATAACTCGAGTTATAATCTGCTCCTTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026225.3-1277s21c1
Sequence:CCGGTTGAGTCTCCATGCGAATAAACTCGAGTTTATTCGCATGGAGACTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279378    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026225.3-2114s21c1
Sequence:CCGGATGCGGTTGTAGGTCAATTTCCTCGAGGAAATTGACCTACAACCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026225.3-1585s21c1
Sequence:CCGGGCGCCTAGAAATGCTTCAGTTCTCGAGAACTGAAGCATTTCTAGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000202304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026225.1-1591s1c1
Sequence:CCGGGCGCCTAGAAATGCTTCAGTTCTCGAGAACTGAAGCATTTCTAGGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026225.1-917s1c1
Sequence:CCGGCCCATTGAAATGCACTCCCATCTCGAGATGGGAGTGCATTTCAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026225.1-245s1c1
Sequence:CCGGCGAAGAAATTTACGTGGTGATCTCGAGATCACCACGTAAATTTCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026225.1-867s1c1
Sequence:CCGGGTGGGTTTATTGATGCTCTTACTCGAGTAAGAGCATCAATAAACCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026225
VALIDATED
COG6 MISSION shRNA Lentiviral Transduction Particles
component of oligomeric golgi complex 6
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000279375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026225.3-861s21c1
Sequence:CCGGGTGGGTTTATTGATGCTCTTACTCGAGTAAGAGCATCAATAAACCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026225.3-1845s21c1
Sequence:CCGGCAGTGAAGGAGCAGATTATAACTCGAGTTATAATCTGCTCCTTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026225.3-1277s21c1
Sequence:CCGGTTGAGTCTCCATGCGAATAAACTCGAGTTTATTCGCATGGAGACTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279378    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026225.3-2114s21c1
Sequence:CCGGATGCGGTTGTAGGTCAATTTCCTCGAGGAAATTGACCTACAACCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026225.3-1585s21c1
Sequence:CCGGGCGCCTAGAAATGCTTCAGTTCTCGAGAACTGAAGCATTTCTAGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000202304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026225.1-1591s1c1
Sequence:CCGGGCGCCTAGAAATGCTTCAGTTCTCGAGAACTGAAGCATTTCTAGGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026225.1-917s1c1
Sequence:CCGGCCCATTGAAATGCACTCCCATCTCGAGATGGGAGTGCATTTCAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026225.1-245s1c1
Sequence:CCGGCGAAGAAATTTACGTGGTGATCTCGAGATCACCACGTAAATTTCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026225.1-867s1c1
Sequence:CCGGGTGGGTTTATTGATGCTCTTACTCGAGTAAGAGCATCAATAAACCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks