EMAIL THIS PAGE TO A FRIEND

COG7

component of oligomeric golgi complex 7

Synonyms: CDG2E
UniProtKB ID: P83436, Q6UWU7
Gene ID:
Human(91949) Summary: The protein encoded by this gene resides in the golgi, and constitutes one of the 8 subunits of the conserved oligomeric Golgi (COG) complex, which is required for normal golgi morphology and localization. Mutations in this gene are associated with the congenital disorder of glycosylation type IIe.[provided by RefSeq, May 2010]
Mouse(233824) component of oligomeric golgi complex 7
Rat(293456) component of oligomeric golgi complex 7
Zebrafish(768247) component of oligomeric golgi complex 7
fruit fly(43547) CG31040 gene product from transcript CG31040-RA
cow(504790) component of oligomeric golgi complex 7
domestic cat(101099517) component of oligomeric golgi complex 7
dog(479808) component of oligomeric golgi complex 7
chicken(416578) component of oligomeric golgi complex 7
sheep(101104954) component of oligomeric golgi complex 7
naked mole-rat(101717909) component of oligomeric golgi complex 7
domestic guinea pig(100716308) component of oligomeric golgi complex 7
52 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001033318 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033318 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033318 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_153603 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153603 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153603 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153603 Rosetta Predictions human pricing
NM_001033889 Rosetta Predictions rat pricing
NM_001033318 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153603 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00116029 predicted 650
2 SASI_Hs02_00367324 predicted 663
3 SASI_Hs01_00116030 predicted 665
4 SASI_Hs01_00116031 predicted 570
5 SASI_Hs01_00116032 predicted 757
6 SASI_Hs01_00116033 predicted 595
7 SASI_Hs02_00367325 predicted 388
8 SASI_Hs01_00116037 predicted 2257
9 SASI_Hs01_00116038 predicted 530
10 SASI_Hs02_00367326 predicted 1228
11 SASI_Hs01_00116034 predicted 790
12 SASI_Hs01_00116035 predicted 1806
13 SASI_Hs01_00116036 predicted 2023
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033889 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00115482 predicted 1716
2 SASI_Rn01_00115483 predicted 557
3 SASI_Rn01_00115484 predicted 385
4 SASI_Rn01_00115485 predicted 1270
5 SASI_Rn01_00115486 predicted 1720
6 SASI_Rn01_00115487 predicted 1142
7 SASI_Rn01_00115488 predicted 661
8 SASI_Rn01_00115489 predicted 2023
9 SASI_Rn01_00115490 predicted 2036
10 SASI_Rn01_00115491 predicted 696
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033318 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00169322 predicted 1733
2 SASI_Mm01_00169323 predicted 1889
3 SASI_Mm01_00169324 predicted 1147
4 SASI_Mm01_00169325 predicted 1722
5 SASI_Mm01_00169326 predicted 360
6 SASI_Mm01_00169327 predicted 394
7 SASI_Mm01_00169328 predicted 2038
8 SASI_Mm01_00169329 predicted 2038
9 SASI_Mm01_00169330 predicted 359
10 SASI_Mm01_00169331 predicted 1722
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033318
VALIDATED
COG7 MISSION shRNA Bacterial Glycerol Stock
component of oligomeric golgi complex 7
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000198509    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001033318.1-2455s1c1
Sequence:CCGGGACTCACCACTGAGAATGAATCTCGAGATTCATTCTCAGTGGTGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181928    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033318.1-585s1c1
Sequence:CCGGGCTTGATGATGCTTGTGGATACTCGAGTATCCACAAGCATCATCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001033318.1-1736s1c1
Sequence:CCGGGCCAGTTTAATGGAAATACTTCTCGAGAAGTATTTCCATTAAACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001033318.1-736s1c1
Sequence:CCGGGTTTACTGAAATCGACCGGATCTCGAGATCCGGTCGATTTCAGTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176656    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001033318.1-2476s1c1
Sequence:CCGGCCATTCATTCATTACAGAGAACTCGAGTTCTCTGTAATGAATGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001033318.1-2245s1c1
Sequence:CCGGCGACATCGACTATCTGATCAACTCGAGTTGATCAGATAGTCGATGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001033318.1-1154s1c1
Sequence:CCGGGCTGTGTATGGTCCCTATAAACTCGAGTTTATAGGGACCATACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217631    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001033318.3-2632s1c1
Sequence:CCGGGAAATTAGGCATGGTGGTATGCTCGAGCATACCACCATGCCTAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033318
VALIDATED
COG7 MISSION shRNA shRNA Plasmid DNA
component of oligomeric golgi complex 7
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000198509    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001033318.1-2455s1c1
Sequence:CCGGGACTCACCACTGAGAATGAATCTCGAGATTCATTCTCAGTGGTGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181928    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033318.1-585s1c1
Sequence:CCGGGCTTGATGATGCTTGTGGATACTCGAGTATCCACAAGCATCATCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001033318.1-1736s1c1
Sequence:CCGGGCCAGTTTAATGGAAATACTTCTCGAGAAGTATTTCCATTAAACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001033318.1-736s1c1
Sequence:CCGGGTTTACTGAAATCGACCGGATCTCGAGATCCGGTCGATTTCAGTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176656    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001033318.1-2476s1c1
Sequence:CCGGCCATTCATTCATTACAGAGAACTCGAGTTCTCTGTAATGAATGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001033318.1-2245s1c1
Sequence:CCGGCGACATCGACTATCTGATCAACTCGAGTTGATCAGATAGTCGATGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001033318.1-1154s1c1
Sequence:CCGGGCTGTGTATGGTCCCTATAAACTCGAGTTTATAGGGACCATACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217631    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001033318.3-2632s1c1
Sequence:CCGGGAAATTAGGCATGGTGGTATGCTCGAGCATACCACCATGCCTAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033318
VALIDATED
COG7 MISSION shRNA Lentiviral Transduction Particles
component of oligomeric golgi complex 7
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000198509    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001033318.1-2455s1c1
Sequence:CCGGGACTCACCACTGAGAATGAATCTCGAGATTCATTCTCAGTGGTGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181928    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033318.1-585s1c1
Sequence:CCGGGCTTGATGATGCTTGTGGATACTCGAGTATCCACAAGCATCATCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001033318.1-1736s1c1
Sequence:CCGGGCCAGTTTAATGGAAATACTTCTCGAGAAGTATTTCCATTAAACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001033318.1-736s1c1
Sequence:CCGGGTTTACTGAAATCGACCGGATCTCGAGATCCGGTCGATTTCAGTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176656    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001033318.1-2476s1c1
Sequence:CCGGCCATTCATTCATTACAGAGAACTCGAGTTCTCTGTAATGAATGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001033318.1-2245s1c1
Sequence:CCGGCGACATCGACTATCTGATCAACTCGAGTTGATCAGATAGTCGATGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001033318.1-1154s1c1
Sequence:CCGGGCTGTGTATGGTCCCTATAAACTCGAGTTTATAGGGACCATACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217631    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001033318.3-2632s1c1
Sequence:CCGGGAAATTAGGCATGGTGGTATGCTCGAGCATACCACCATGCCTAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153603
VALIDATED
COG7 MISSION shRNA Bacterial Glycerol Stock
component of oligomeric golgi complex 7
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_153603.1-592s1c1
Sequence:CCGGGCCGATATTGAGGAGACATTTCTCGAGAAATGTCTCCTCAATATCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153603.1-2331s1c1
Sequence:CCGGCGACTATCTGATCAACGTGATCTCGAGATCACGTTGATCAGATAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130051    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153603.1-1965s1c1
Sequence:CCGGGCTGTTGCTTATTTCGAAGATCTCGAGATCTTCGAAATAAGCAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129500    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153603.1-321s1c1
Sequence:CCGGGCTGTTCATCCAAGAGGTGAACTCGAGTTCACCTCTTGGATGAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129424    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153603.1-2567s1c1
Sequence:CCGGCTCAGAAACTCTGCCCAAGATCTCGAGATCTTGGGCAGAGTTTCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153603.1-1234s1c1
Sequence:CCGGGCTGTGTATGATCCATACAAACTCGAGTTTGTATGGATCATACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153603.1-675s1c1
Sequence:CCGGGCTTGTTGATACACCAGACTACTCGAGTAGTCTGGTGTATCAACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128035    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153603.1-447s1c1
Sequence:CCGGGATTCTTGTCAAGGAGGACATCTCGAGATGTCCTCCTTGACAAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153603.1-1803s1c1
Sequence:CCGGCCCTGCTGAATATGCCAGTTTCTCGAGAAACTGGCATATTCAGCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_153603.1-536s1c1
Sequence:CCGGGAATGCAACTTGCTGCCGAATCTCGAGATTCGGCAGCAAGTTGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153603.2-449s21c1
Sequence:CCGGGATTCTTGTCAAGGAGGACATCTCGAGATGTCCTCCTTGACAAGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153603.2-2333s21c1
Sequence:CCGGCGACTATCTGATCAACGTGATCTCGAGATCACGTTGATCAGATAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153603.2-677s21c1
Sequence:CCGGGCTTGTTGATACACCAGACTACTCGAGTAGTCTGGTGTATCAACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153603.2-538s21c1
Sequence:CCGGGAATGCAACTTGCTGCCGAATCTCGAGATTCGGCAGCAAGTTGCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153603
VALIDATED
COG7 MISSION shRNA shRNA Plasmid DNA
component of oligomeric golgi complex 7
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_153603.1-592s1c1
Sequence:CCGGGCCGATATTGAGGAGACATTTCTCGAGAAATGTCTCCTCAATATCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153603.1-2331s1c1
Sequence:CCGGCGACTATCTGATCAACGTGATCTCGAGATCACGTTGATCAGATAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130051    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153603.1-1965s1c1
Sequence:CCGGGCTGTTGCTTATTTCGAAGATCTCGAGATCTTCGAAATAAGCAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129500    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153603.1-321s1c1
Sequence:CCGGGCTGTTCATCCAAGAGGTGAACTCGAGTTCACCTCTTGGATGAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129424    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153603.1-2567s1c1
Sequence:CCGGCTCAGAAACTCTGCCCAAGATCTCGAGATCTTGGGCAGAGTTTCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153603.1-1234s1c1
Sequence:CCGGGCTGTGTATGATCCATACAAACTCGAGTTTGTATGGATCATACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153603.1-675s1c1
Sequence:CCGGGCTTGTTGATACACCAGACTACTCGAGTAGTCTGGTGTATCAACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128035    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153603.1-447s1c1
Sequence:CCGGGATTCTTGTCAAGGAGGACATCTCGAGATGTCCTCCTTGACAAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153603.1-1803s1c1
Sequence:CCGGCCCTGCTGAATATGCCAGTTTCTCGAGAAACTGGCATATTCAGCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_153603.1-536s1c1
Sequence:CCGGGAATGCAACTTGCTGCCGAATCTCGAGATTCGGCAGCAAGTTGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153603.2-449s21c1
Sequence:CCGGGATTCTTGTCAAGGAGGACATCTCGAGATGTCCTCCTTGACAAGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153603.2-2333s21c1
Sequence:CCGGCGACTATCTGATCAACGTGATCTCGAGATCACGTTGATCAGATAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153603.2-677s21c1
Sequence:CCGGGCTTGTTGATACACCAGACTACTCGAGTAGTCTGGTGTATCAACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153603.2-538s21c1
Sequence:CCGGGAATGCAACTTGCTGCCGAATCTCGAGATTCGGCAGCAAGTTGCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153603
VALIDATED
COG7 MISSION shRNA Lentiviral Transduction Particles
component of oligomeric golgi complex 7
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_153603.1-592s1c1
Sequence:CCGGGCCGATATTGAGGAGACATTTCTCGAGAAATGTCTCCTCAATATCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153603.1-2331s1c1
Sequence:CCGGCGACTATCTGATCAACGTGATCTCGAGATCACGTTGATCAGATAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130051    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153603.1-1965s1c1
Sequence:CCGGGCTGTTGCTTATTTCGAAGATCTCGAGATCTTCGAAATAAGCAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129500    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153603.1-321s1c1
Sequence:CCGGGCTGTTCATCCAAGAGGTGAACTCGAGTTCACCTCTTGGATGAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129424    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153603.1-2567s1c1
Sequence:CCGGCTCAGAAACTCTGCCCAAGATCTCGAGATCTTGGGCAGAGTTTCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153603.1-1234s1c1
Sequence:CCGGGCTGTGTATGATCCATACAAACTCGAGTTTGTATGGATCATACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153603.1-675s1c1
Sequence:CCGGGCTTGTTGATACACCAGACTACTCGAGTAGTCTGGTGTATCAACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128035    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153603.1-447s1c1
Sequence:CCGGGATTCTTGTCAAGGAGGACATCTCGAGATGTCCTCCTTGACAAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153603.1-1803s1c1
Sequence:CCGGCCCTGCTGAATATGCCAGTTTCTCGAGAAACTGGCATATTCAGCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_153603.1-536s1c1
Sequence:CCGGGAATGCAACTTGCTGCCGAATCTCGAGATTCGGCAGCAAGTTGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153603.2-449s21c1
Sequence:CCGGGATTCTTGTCAAGGAGGACATCTCGAGATGTCCTCCTTGACAAGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153603.2-2333s21c1
Sequence:CCGGCGACTATCTGATCAACGTGATCTCGAGATCACGTTGATCAGATAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153603.2-677s21c1
Sequence:CCGGGCTTGTTGATACACCAGACTACTCGAGTAGTCTGGTGTATCAACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153603.2-538s21c1
Sequence:CCGGGAATGCAACTTGCTGCCGAATCTCGAGATTCGGCAGCAAGTTGCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks