EMAIL THIS PAGE TO A FRIEND

COG8

component of oligomeric golgi complex 8

63 Gene Product Result for
Synonyms: CDG2H DOR1
UniProtKB ID: Q96MW5, Q0VAK2, Q8WVV6, Q9H6F8
Gene ID:
Human(84342) Summary: This gene encodes a protein that is a component of the conserved oligomeric Golgi (COG) complex, a multiprotein complex that plays a structural role in the Golgi apparatus, and is involved in intracellular membrane trafficking and glycoprotein modification. Mutations in this gene cause congenital disorder of glycosylation, type IIh, a disease that is characterized by under-glycosylated serum proteins, and whose symptoms include severe psychomotor retardation, failure to thrive, seizures, and dairy and wheat product intolerance. [provided by RefSeq, Jul 2008]
Mouse(97484) component of oligomeric golgi complex 8
Rat(291990) component of oligomeric golgi complex 8
domestic guinea pig(100724110) component of oligomeric golgi complex 8
naked mole-rat(101714461) component of oligomeric golgi complex 8
sheep(101113170) component of oligomeric golgi complex 8
Zebrafish(541379) component of oligomeric golgi complex 8
chicken(769684) component of oligomeric golgi complex 8
domestic cat(101083131) component of oligomeric golgi complex 8
cow(768007) component of oligomeric golgi complex 8
Horse(100067058) component of oligomeric golgi complex 8
dog(489737) component of oligomeric golgi complex 8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032382 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032382 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032382 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_139229 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_139229 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_139229 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU086521 MISSION® esiRNA esiRNA targeting mouse Cog8 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032382 Rosetta Predictions human pricing
NM_001106182 Rosetta Predictions rat pricing
NM_139229 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032382 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00173887 predicted 2153
2 SASI_Hs01_00173888 predicted 2257
3 SASI_Hs02_00359776 predicted 2184
4 SASI_Hs01_00173889 predicted 2143
5 SASI_Hs01_00173890 predicted 2257
6 SASI_Hs01_00173891 predicted 2254
7 SASI_Hs01_00173893 predicted 2171
8 SASI_Hs01_00173894 predicted 2159
9 SASI_Hs01_00173895 predicted 2145
10 SASI_Hs02_00359777 predicted 2180
11 SASI_Hs01_00173886 predicted 2176
12 SASI_Hs01_00173892 predicted 2144
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106182 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00216438 predicted 943
2 SASI_Rn02_00216439 predicted 557
3 SASI_Rn02_00216440 predicted 454
4 SASI_Rn02_00216441 predicted 1633
5 SASI_Rn02_00216442 predicted 1578
6 SASI_Rn02_00216443 predicted 825
7 SASI_Rn02_00216444 predicted 1422
8 SASI_Rn02_00216445 predicted 818
9 SASI_Rn02_00216446 predicted 1542
10 SASI_Rn02_00216447 predicted 1356
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139229 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00339950 predicted 446
2 SASI_Mm02_00339951 predicted 830
3 SASI_Mm02_00339952 predicted 610
4 SASI_Mm02_00339953 predicted 461
5 SASI_Mm02_00339954 predicted 468
6 SASI_Mm02_00339955 predicted 453
7 SASI_Mm02_00339956 predicted 564
8 SASI_Mm02_00339957 predicted 723
9 SASI_Mm02_00339958 predicted 1158
10 SASI_Mm02_00339959 predicted 831
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032382
VALIDATED
COG8 MISSION shRNA Bacterial Glycerol Stock
component of oligomeric golgi complex 8
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000370737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032382.4-565s21c1
Sequence:CCGGGTGTCCGGAACAGTTATTATGCTCGAGCATAATAACTGTTCCGGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032382.4-1028s21c1
Sequence:CCGGGCTACAGAAGGTCTCACAATTCTCGAGAATTGTGAGACCTTCTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032382.4-1473s21c1
Sequence:CCGGGCCCTTGCCAAGGTAACTAAACTCGAGTTTAGTTACCTTGGCAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032382.4-492s21c1
Sequence:CCGGATGAATAGCCTGACCCTAAACCTCGAGGTTTAGGGTCAGGCTATTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032382.4-858s21c1
Sequence:CCGGCCTAATGATGATCCCTATTTCCTCGAGGAAATAGGGATCATCATTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032382.2-1566s1c1
Sequence:CCGGCTGGAAGACCTTGTTCCGTATCTCGAGATACGGAACAAGGTCTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032382.2-1361s1c1
Sequence:CCGGCCTCGCCTGCTTTCTCAACAACTCGAGTTGTTGAGAAAGCAGGCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121707    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032382.2-2236s1c1
Sequence:CCGGCAGAAATGTTTGCCCTGAAATCTCGAGATTTCAGGGCAAACATTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145505    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032382.2-2146s1c1
Sequence:CCGGGCAAATCTTACTTGGCATCAACTCGAGTTGATGCCAAGTAAGATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145491    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032382.2-1569s1c1
Sequence:CCGGGAAGACCTTGTTCCGTATTTACTCGAGTAAATACGGAACAAGGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145184    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032382.2-2310s1c1
Sequence:CCGGGAGTGGACATTTCCTAACAATCTCGAGATTGTTAGGAAATGTCCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032382
VALIDATED
COG8 MISSION shRNA shRNA Plasmid DNA
component of oligomeric golgi complex 8
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000370737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032382.4-565s21c1
Sequence:CCGGGTGTCCGGAACAGTTATTATGCTCGAGCATAATAACTGTTCCGGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032382.4-1028s21c1
Sequence:CCGGGCTACAGAAGGTCTCACAATTCTCGAGAATTGTGAGACCTTCTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032382.4-1473s21c1
Sequence:CCGGGCCCTTGCCAAGGTAACTAAACTCGAGTTTAGTTACCTTGGCAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032382.4-492s21c1
Sequence:CCGGATGAATAGCCTGACCCTAAACCTCGAGGTTTAGGGTCAGGCTATTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032382.4-858s21c1
Sequence:CCGGCCTAATGATGATCCCTATTTCCTCGAGGAAATAGGGATCATCATTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032382.2-1566s1c1
Sequence:CCGGCTGGAAGACCTTGTTCCGTATCTCGAGATACGGAACAAGGTCTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032382.2-1361s1c1
Sequence:CCGGCCTCGCCTGCTTTCTCAACAACTCGAGTTGTTGAGAAAGCAGGCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121707    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032382.2-2236s1c1
Sequence:CCGGCAGAAATGTTTGCCCTGAAATCTCGAGATTTCAGGGCAAACATTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145505    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032382.2-2146s1c1
Sequence:CCGGGCAAATCTTACTTGGCATCAACTCGAGTTGATGCCAAGTAAGATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145491    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032382.2-1569s1c1
Sequence:CCGGGAAGACCTTGTTCCGTATTTACTCGAGTAAATACGGAACAAGGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145184    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032382.2-2310s1c1
Sequence:CCGGGAGTGGACATTTCCTAACAATCTCGAGATTGTTAGGAAATGTCCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032382
VALIDATED
COG8 MISSION shRNA Lentiviral Transduction Particles
component of oligomeric golgi complex 8
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000370737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032382.4-565s21c1
Sequence:CCGGGTGTCCGGAACAGTTATTATGCTCGAGCATAATAACTGTTCCGGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032382.4-1028s21c1
Sequence:CCGGGCTACAGAAGGTCTCACAATTCTCGAGAATTGTGAGACCTTCTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032382.4-1473s21c1
Sequence:CCGGGCCCTTGCCAAGGTAACTAAACTCGAGTTTAGTTACCTTGGCAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032382.4-492s21c1
Sequence:CCGGATGAATAGCCTGACCCTAAACCTCGAGGTTTAGGGTCAGGCTATTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032382.4-858s21c1
Sequence:CCGGCCTAATGATGATCCCTATTTCCTCGAGGAAATAGGGATCATCATTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032382.2-1566s1c1
Sequence:CCGGCTGGAAGACCTTGTTCCGTATCTCGAGATACGGAACAAGGTCTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032382.2-1361s1c1
Sequence:CCGGCCTCGCCTGCTTTCTCAACAACTCGAGTTGTTGAGAAAGCAGGCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121707    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032382.2-2236s1c1
Sequence:CCGGCAGAAATGTTTGCCCTGAAATCTCGAGATTTCAGGGCAAACATTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145505    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032382.2-2146s1c1
Sequence:CCGGGCAAATCTTACTTGGCATCAACTCGAGTTGATGCCAAGTAAGATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145491    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032382.2-1569s1c1
Sequence:CCGGGAAGACCTTGTTCCGTATTTACTCGAGTAAATACGGAACAAGGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145184    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032382.2-2310s1c1
Sequence:CCGGGAGTGGACATTTCCTAACAATCTCGAGATTGTTAGGAAATGTCCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139229
VALIDATED
COG8 MISSION shRNA Bacterial Glycerol Stock
component of oligomeric golgi complex 8
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000248767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_139229.3-1604s21c1
Sequence:CCGGTAGCCCAGACTTTAGGCATTTCTCGAGAAATGCCTAAAGTCTGGGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_139229.3-893s21c1
Sequence:CCGGTCACCCAGTACCGTGCTATTTCTCGAGAAATAGCACGGTACTGGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248769    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139229.3-3810s21c1
Sequence:CCGGGACTACAAATGTACCATTAAACTCGAGTTTAATGGTACATTTGTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_139229.3-290s21c1
Sequence:CCGGCCAACTACAAGACGTTCATTCCTCGAGGAATGAACGTCTTGTAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_139229.3-1680s21c1
Sequence:CCGGCCAGGAACCTCTCGCCTTTATCTCGAGATAAAGGCGAGAGGTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139229
VALIDATED
COG8 MISSION shRNA shRNA Plasmid DNA
component of oligomeric golgi complex 8
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000248767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_139229.3-1604s21c1
Sequence:CCGGTAGCCCAGACTTTAGGCATTTCTCGAGAAATGCCTAAAGTCTGGGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_139229.3-893s21c1
Sequence:CCGGTCACCCAGTACCGTGCTATTTCTCGAGAAATAGCACGGTACTGGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248769    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139229.3-3810s21c1
Sequence:CCGGGACTACAAATGTACCATTAAACTCGAGTTTAATGGTACATTTGTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_139229.3-290s21c1
Sequence:CCGGCCAACTACAAGACGTTCATTCCTCGAGGAATGAACGTCTTGTAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_139229.3-1680s21c1
Sequence:CCGGCCAGGAACCTCTCGCCTTTATCTCGAGATAAAGGCGAGAGGTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139229
VALIDATED
COG8 MISSION shRNA Lentiviral Transduction Particles
component of oligomeric golgi complex 8
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000248767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_139229.3-1604s21c1
Sequence:CCGGTAGCCCAGACTTTAGGCATTTCTCGAGAAATGCCTAAAGTCTGGGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_139229.3-893s21c1
Sequence:CCGGTCACCCAGTACCGTGCTATTTCTCGAGAAATAGCACGGTACTGGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248769    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139229.3-3810s21c1
Sequence:CCGGGACTACAAATGTACCATTAAACTCGAGTTTAATGGTACATTTGTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_139229.3-290s21c1
Sequence:CCGGCCAACTACAAGACGTTCATTCCTCGAGGAATGAACGTCTTGTAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_139229.3-1680s21c1
Sequence:CCGGCCAGGAACCTCTCGCCTTTATCTCGAGATAAAGGCGAGAGGTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks