EMAIL THIS PAGE TO A FRIEND

COIL

coilin

129 Gene Product Result for
Synonyms: CLN80 p80-coilin
UniProtKB ID: P38432, B2R931
Gene ID:
Human(8161) Summary: The protein encoded by this gene is an integral component of Cajal bodies (also called coiled bodies). Cajal bodies are nuclear suborganelles of varying number and composition that are involved in the post-transcriptional modification of small nuclear and small nucleolar RNAs. The N-terminus of the coilin protein directs its self-oligomerization while the C-terminus influences the number of nuclear bodies assembled per cell. Differential methylation and phosphorylation of coilin likely influences its localization among nuclear bodies and the composition and assembly of Cajal bodies. This gene has pseudogenes on chromosome 4 and chromosome 14. [provided by RefSeq, Jul 2008]
Mouse(12812) coilin
Rat(50998) coilin
Zebrafish(58024) coilin p80
cow(507580) coilin
dog(480564) coilin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004645 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004645 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004645 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016706 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016706 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016706 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004645 Rosetta Predictions human pricing
NM_017360 Rosetta Predictions rat pricing
NM_016706 Rosetta Predictions mouse pricing
NM_181329 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004645 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00179865 predicted 955
2 SASI_Hs01_00179866 predicted 1363
3 SASI_Hs01_00179868 predicted 844
4 SASI_Hs01_00179869 predicted 972
5 SASI_Hs01_00179870 predicted 899
6 SASI_Hs01_00179871 predicted 1342
7 SASI_Hs01_00179872 predicted 1405
8 SASI_Hs02_00338054 predicted 842
9 SASI_Hs01_00179874 predicted 848
10 SASI_Hs02_00338055 predicted 873
11 SASI_Hs01_00179867 predicted 1593
12 SASI_Hs01_00179873 predicted 1297
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017360 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00097988 predicted 603
2 SASI_Rn01_00097989 predicted 1293
3 SASI_Rn01_00097990 predicted 1544
4 SASI_Rn01_00097991 predicted 1353
5 SASI_Rn01_00097992 predicted 291
6 SASI_Rn01_00097993 predicted 1561
7 SASI_Rn01_00097994 predicted 1443
8 SASI_Rn02_00261851 predicted 1464
9 SASI_Rn01_00097995 predicted 1364
10 SASI_Rn01_00097996 predicted 1428
11 SASI_Rn01_00097997 predicted 815
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016706 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00323380 predicted 1376
2 SASI_Mm02_00323381 predicted 1135
3 SASI_Mm01_00083268 predicted 1451
4 SASI_Mm02_00323382 predicted 1331
5 SASI_Mm02_00323383 predicted 1382
6 SASI_Mm01_00083270 predicted 1468
7 SASI_Mm01_00083271 predicted 1585
8 SASI_Mm02_00323384 predicted 1321
9 SASI_Mm02_00323385 predicted 1828
10 SASI_Mm02_00323386 predicted 309
11 SASI_Mm01_00083265 predicted 1558
12 SASI_Mm01_00083266 predicted 2190
13 SASI_Mm01_00083267 predicted 2128
14 SASI_Mm01_00083269 predicted 980
15 SASI_Mm01_00083272 predicted 2105
16 SASI_Mm01_00083273 predicted 950
17 SASI_Mm01_00083274 predicted 2105
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181329 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00096140 predicted 1590
2 SASI_Mm01_00096141 predicted 2216
3 SASI_Mm01_00096142 predicted 2167
4 SASI_Mm01_00096143 predicted 1481
5 SASI_Mm01_00096144 predicted 1004
6 SASI_Mm01_00096145 predicted 1487
7 SASI_Mm01_00096146 predicted 1599
8 SASI_Mm01_00096147 predicted 2129
9 SASI_Mm01_00096148 predicted 987
10 SASI_Mm01_00096149 predicted 2138
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004645
VALIDATED
COIL MISSION shRNA Bacterial Glycerol Stock
coilin
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000122656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_004645.1-415s1c1
Sequence:CCGGGCATTGGAAGAGTCGAGAGAACTCGAGTTCTCTCGACTCTTCCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004645.1-1592s1c1
Sequence:CCGGCCTGGGAAATTTGATTTAGTTCTCGAGAACTAAATCAAATTTCCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004645.1-1034s1c1
Sequence:CCGGGCGGGTTTCTTAAAGACAGTACTCGAGTACTGTCTTTAAGAAACCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004645.1-629s1c1
Sequence:CCGGCCGAAAGTACAGGCAGTGAAACTCGAGTTTCACTGCCTGTACTTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139182    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004645.1-1581s1c1
Sequence:CCGGCCTTGAGAGAACCTGGGAAATCTCGAGATTTCCCAGGTTCTCTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145151    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_004645.1-2267s1c1
Sequence:CCGGGCAGACAATGAGTTAAGGAATCTCGAGATTCCTTAACTCATTGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144996    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004645.1-308s1c1
Sequence:CCGGGTCATCAGTAATGGTGACATTCTCGAGAATGTCACCATTACTGATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144467    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004645.1-1331s1c1
Sequence:CCGGCAGCAATTAAATGACGTGGTACTCGAGTACCACGTCATTTAATTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144879    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004645.1-1502s1c1
Sequence:CCGGGACTACAAGGAAGGAAGAATACTCGAGTATTCTTCCTTCCTTGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144976    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004645.1-424s1c1
Sequence:CCGGGAGTCGAGAGAACAATAACAACTCGAGTTGTTATTGTTCTCTCGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_004645.2-424s21c1
Sequence:CCGGGCATTGGAAGAGTCGAGAGAACTCGAGTTCTCTCGACTCTTCCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004645.2-638s21c1
Sequence:CCGGCCGAAAGTACAGGCAGTGAAACTCGAGTTTCACTGCCTGTACTTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_004645.2-1511s21c1
Sequence:CCGGGACTACAAGGAAGGAAGAATACTCGAGTATTCTTCCTTCCTTGTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_004645.2-433s21c1
Sequence:CCGGGAGTCGAGAGAACAATAACAACTCGAGTTGTTATTGTTCTCTCGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004645
VALIDATED
COIL MISSION shRNA shRNA Plasmid DNA
coilin
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000122656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_004645.1-415s1c1
Sequence:CCGGGCATTGGAAGAGTCGAGAGAACTCGAGTTCTCTCGACTCTTCCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004645.1-1592s1c1
Sequence:CCGGCCTGGGAAATTTGATTTAGTTCTCGAGAACTAAATCAAATTTCCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004645.1-1034s1c1
Sequence:CCGGGCGGGTTTCTTAAAGACAGTACTCGAGTACTGTCTTTAAGAAACCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004645.1-629s1c1
Sequence:CCGGCCGAAAGTACAGGCAGTGAAACTCGAGTTTCACTGCCTGTACTTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139182    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004645.1-1581s1c1
Sequence:CCGGCCTTGAGAGAACCTGGGAAATCTCGAGATTTCCCAGGTTCTCTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145151    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_004645.1-2267s1c1
Sequence:CCGGGCAGACAATGAGTTAAGGAATCTCGAGATTCCTTAACTCATTGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144996    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004645.1-308s1c1
Sequence:CCGGGTCATCAGTAATGGTGACATTCTCGAGAATGTCACCATTACTGATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144467    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004645.1-1331s1c1
Sequence:CCGGCAGCAATTAAATGACGTGGTACTCGAGTACCACGTCATTTAATTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144879    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004645.1-1502s1c1
Sequence:CCGGGACTACAAGGAAGGAAGAATACTCGAGTATTCTTCCTTCCTTGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144976    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004645.1-424s1c1
Sequence:CCGGGAGTCGAGAGAACAATAACAACTCGAGTTGTTATTGTTCTCTCGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_004645.2-424s21c1
Sequence:CCGGGCATTGGAAGAGTCGAGAGAACTCGAGTTCTCTCGACTCTTCCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004645.2-638s21c1
Sequence:CCGGCCGAAAGTACAGGCAGTGAAACTCGAGTTTCACTGCCTGTACTTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_004645.2-1511s21c1
Sequence:CCGGGACTACAAGGAAGGAAGAATACTCGAGTATTCTTCCTTCCTTGTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_004645.2-433s21c1
Sequence:CCGGGAGTCGAGAGAACAATAACAACTCGAGTTGTTATTGTTCTCTCGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004645
VALIDATED
COIL MISSION shRNA Lentiviral Transduction Particles
coilin
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000122656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_004645.1-415s1c1
Sequence:CCGGGCATTGGAAGAGTCGAGAGAACTCGAGTTCTCTCGACTCTTCCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004645.1-1592s1c1
Sequence:CCGGCCTGGGAAATTTGATTTAGTTCTCGAGAACTAAATCAAATTTCCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004645.1-1034s1c1
Sequence:CCGGGCGGGTTTCTTAAAGACAGTACTCGAGTACTGTCTTTAAGAAACCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004645.1-629s1c1
Sequence:CCGGCCGAAAGTACAGGCAGTGAAACTCGAGTTTCACTGCCTGTACTTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139182    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004645.1-1581s1c1
Sequence:CCGGCCTTGAGAGAACCTGGGAAATCTCGAGATTTCCCAGGTTCTCTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145151    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_004645.1-2267s1c1
Sequence:CCGGGCAGACAATGAGTTAAGGAATCTCGAGATTCCTTAACTCATTGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144996    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004645.1-308s1c1
Sequence:CCGGGTCATCAGTAATGGTGACATTCTCGAGAATGTCACCATTACTGATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144467    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004645.1-1331s1c1
Sequence:CCGGCAGCAATTAAATGACGTGGTACTCGAGTACCACGTCATTTAATTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144879    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004645.1-1502s1c1
Sequence:CCGGGACTACAAGGAAGGAAGAATACTCGAGTATTCTTCCTTCCTTGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144976    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004645.1-424s1c1
Sequence:CCGGGAGTCGAGAGAACAATAACAACTCGAGTTGTTATTGTTCTCTCGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_004645.2-424s21c1
Sequence:CCGGGCATTGGAAGAGTCGAGAGAACTCGAGTTCTCTCGACTCTTCCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004645.2-638s21c1
Sequence:CCGGCCGAAAGTACAGGCAGTGAAACTCGAGTTTCACTGCCTGTACTTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_004645.2-1511s21c1
Sequence:CCGGGACTACAAGGAAGGAAGAATACTCGAGTATTCTTCCTTCCTTGTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_004645.2-433s21c1
Sequence:CCGGGAGTCGAGAGAACAATAACAACTCGAGTTGTTATTGTTCTCTCGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016706
VALIDATED
COIL MISSION shRNA Bacterial Glycerol Stock
coilin
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201771    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016706.1-2059s1c1
Sequence:CCGGGCTGTGCATCTTGCTTTGTTTCTCGAGAAACAAAGCAAGATGCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201578    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016706.1-1685s1c1
Sequence:CCGGCATTGACTCTTCAGGTAGCATCTCGAGATGCTACCTGAAGAGTCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016706.1-1301s1c1
Sequence:CCGGGCAGAGACAGTTAAACGATATCTCGAGATATCGTTTAACTGTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191020    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016706.1-1876s1c1
Sequence:CCGGCCTCATCATTTAGAGTAACAACTCGAGTTGTTACTCTAAATGATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016706.1-1302s1c1
Sequence:CCGGCAGAGACAGTTAAACGATATTCTCGAGAATATCGTTTAACTGTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016706.1-1365s1c1
Sequence:CCGGCCCAAGAAGGACTATAGTCTACTCGAGTAGACTATAGTCCTTCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190253    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016706.1-1185s1c1
Sequence:CCGGCGAGGAGAGGACTTGTTGTTTCTCGAGAAACAACAAGTCCTCTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016706
VALIDATED
COIL MISSION shRNA shRNA Plasmid DNA
coilin
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201771    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016706.1-2059s1c1
Sequence:CCGGGCTGTGCATCTTGCTTTGTTTCTCGAGAAACAAAGCAAGATGCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201578    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016706.1-1685s1c1
Sequence:CCGGCATTGACTCTTCAGGTAGCATCTCGAGATGCTACCTGAAGAGTCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016706.1-1301s1c1
Sequence:CCGGGCAGAGACAGTTAAACGATATCTCGAGATATCGTTTAACTGTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191020    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016706.1-1876s1c1
Sequence:CCGGCCTCATCATTTAGAGTAACAACTCGAGTTGTTACTCTAAATGATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016706.1-1302s1c1
Sequence:CCGGCAGAGACAGTTAAACGATATTCTCGAGAATATCGTTTAACTGTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016706.1-1365s1c1
Sequence:CCGGCCCAAGAAGGACTATAGTCTACTCGAGTAGACTATAGTCCTTCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190253    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016706.1-1185s1c1
Sequence:CCGGCGAGGAGAGGACTTGTTGTTTCTCGAGAAACAACAAGTCCTCTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016706
VALIDATED
COIL MISSION shRNA Lentiviral Transduction Particles
coilin
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201771    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016706.1-2059s1c1
Sequence:CCGGGCTGTGCATCTTGCTTTGTTTCTCGAGAAACAAAGCAAGATGCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201578    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016706.1-1685s1c1
Sequence:CCGGCATTGACTCTTCAGGTAGCATCTCGAGATGCTACCTGAAGAGTCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016706.1-1301s1c1
Sequence:CCGGGCAGAGACAGTTAAACGATATCTCGAGATATCGTTTAACTGTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191020    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016706.1-1876s1c1
Sequence:CCGGCCTCATCATTTAGAGTAACAACTCGAGTTGTTACTCTAAATGATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016706.1-1302s1c1
Sequence:CCGGCAGAGACAGTTAAACGATATTCTCGAGAATATCGTTTAACTGTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016706.1-1365s1c1
Sequence:CCGGCCCAAGAAGGACTATAGTCTACTCGAGTAGACTATAGTCCTTCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190253    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016706.1-1185s1c1
Sequence:CCGGCGAGGAGAGGACTTGTTGTTTCTCGAGAAACAACAAGTCCTCTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks