EMAIL THIS PAGE TO A FRIEND

COL10A1

collagen, type X, alpha 1

75 Gene Product Result for
UniProtKB ID: Q03692, A1L4P2
Gene ID:
Human(1300) Summary: This gene encodes the alpha chain of type X collagen, a short chain collagen expressed by hypertrophic chondrocytes during endochondral ossification. Unlike type VIII collagen, the other short chain collagen, type X collagen is a homotrimer. Mutations in this gene are associated with Schmid type metaphyseal chondrodysplasia (SMCD) and Japanese type spondylometaphyseal dysplasia (SMD). [provided by RefSeq, Jul 2008]
Mouse(12813) collagen, type X, alpha 1
Rat(25681) collagen, type X, alpha 1
Zebrafish(558919) collagen, type X, alpha 1
chicken(100126150) collagen, type X, alpha 1
dog(611118) collagen, type X, alpha 1
domestic cat(101089191) collagen, type X, alpha 1
cow(282416) collagen, type X, alpha 1
naked mole-rat(101708196) collagen, type X, alpha 1
sheep(101106693) collagen, type X, alpha 1
Domestic Rabbit(100008763) collagen, type X, alpha 1
Gene Class: Calcium_Binding
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000493 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000493 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000493 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009925 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009925 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009925 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000493 Rosetta Predictions human pricing
XM_001053056 Rosetta Predictions rat pricing
NM_009925 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000493 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00220341 predicted 2129
2 SASI_Hs01_00220342 predicted 783
3 SASI_Hs01_00220346 predicted 1448
4 SASI_Hs02_00302651 predicted 228
5 SASI_Hs02_00302652 predicted 220
6 SASI_Hs02_00302653 predicted 227
7 SASI_Hs01_00220340 predicted 1911
8 SASI_Hs01_00220343 predicted 1867
9 SASI_Hs01_00220344 predicted 1960
10 SASI_Hs01_00220345 predicted 1848
11 SASI_Hs01_00220347 predicted 1918
12 SASI_Hs01_00220348 predicted 1858
13 SASI_Hs01_00220349 predicted 2161
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001053056 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00271140 predicted 1136
2 SASI_Rn02_00271141 predicted 1085
3 SASI_Rn02_00271142 predicted 988
4 SASI_Rn02_00271143 predicted 1271
5 SASI_Rn02_00271144 predicted 927
6 SASI_Rn02_00271145 predicted 1218
7 SASI_Rn02_00271146 predicted 967
8 SASI_Rn02_00271147 predicted 1240
9 SASI_Rn02_00271148 predicted 1196
10 SASI_Rn02_00271149 predicted 990
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009925 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00076991 predicted 1896
2 SASI_Mm01_00076992 predicted 213
3 SASI_Mm01_00076994 predicted 1996
4 SASI_Mm01_00076995 predicted 1946
5 SASI_Mm01_00076996 predicted 1838
6 SASI_Mm02_00317467 predicted 1852
7 SASI_Mm01_00076997 predicted 224
8 SASI_Mm01_00076998 predicted 1154
9 SASI_Mm01_00076999 predicted 1447
10 SASI_Mm01_00077000 predicted 1262
11 SASI_Mm01_00076993 predicted 810
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000493
COL10A1 MISSION shRNA Bacterial Glycerol Stock
collagen, type X, alpha 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000493.3-1872s21c1
Sequence:CCGGGATACCAGGAATATACTATTTCTCGAGAAATAGTATATTCCTGGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415520    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000493.3-2571s21c1
Sequence:CCGGCATCCAGGAGGTATCATATAACTCGAGTTATATGATACCTCCTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417638    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000493.3-2499s21c1
Sequence:CCGGGATTTGAGAAACTCGGCATTTCTCGAGAAATGCCGAGTTTCTCAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082798    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000493.2-3123s1c1
Sequence:CCGGCCTCACTTATTAAAGCACAAACTCGAGTTTGTGCTTTAATAAGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000493.2-791s1c1
Sequence:CCGGGCATCAAAGGTGATAGAGGTTCTCGAGAACCTCTATCACCTTTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000493.2-2066s1c1
Sequence:CCGGCCGAGTCAAATGGCCTATACTCTCGAGAGTATAGGCCATTTGACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000493.2-1954s1c1
Sequence:CCGGCCTGTAATGTACACCTATGATCTCGAGATCATAGGTGTACATTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000493.2-229s1c1
Sequence:CCGGCCCTACACCATAAAGAGTAAACTCGAGTTTACTCTTTATGGTGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000493
COL10A1 MISSION shRNA shRNA Plasmid DNA
collagen, type X, alpha 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000493.3-1872s21c1
Sequence:CCGGGATACCAGGAATATACTATTTCTCGAGAAATAGTATATTCCTGGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415520    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000493.3-2571s21c1
Sequence:CCGGCATCCAGGAGGTATCATATAACTCGAGTTATATGATACCTCCTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417638    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000493.3-2499s21c1
Sequence:CCGGGATTTGAGAAACTCGGCATTTCTCGAGAAATGCCGAGTTTCTCAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082798    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000493.2-3123s1c1
Sequence:CCGGCCTCACTTATTAAAGCACAAACTCGAGTTTGTGCTTTAATAAGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000493.2-791s1c1
Sequence:CCGGGCATCAAAGGTGATAGAGGTTCTCGAGAACCTCTATCACCTTTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000493.2-2066s1c1
Sequence:CCGGCCGAGTCAAATGGCCTATACTCTCGAGAGTATAGGCCATTTGACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000493.2-1954s1c1
Sequence:CCGGCCTGTAATGTACACCTATGATCTCGAGATCATAGGTGTACATTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000493.2-229s1c1
Sequence:CCGGCCCTACACCATAAAGAGTAAACTCGAGTTTACTCTTTATGGTGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000493
COL10A1 MISSION shRNA Lentiviral Transduction Particles
collagen, type X, alpha 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000493.3-1872s21c1
Sequence:CCGGGATACCAGGAATATACTATTTCTCGAGAAATAGTATATTCCTGGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415520    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000493.3-2571s21c1
Sequence:CCGGCATCCAGGAGGTATCATATAACTCGAGTTATATGATACCTCCTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417638    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000493.3-2499s21c1
Sequence:CCGGGATTTGAGAAACTCGGCATTTCTCGAGAAATGCCGAGTTTCTCAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082798    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000493.2-3123s1c1
Sequence:CCGGCCTCACTTATTAAAGCACAAACTCGAGTTTGTGCTTTAATAAGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000493.2-791s1c1
Sequence:CCGGGCATCAAAGGTGATAGAGGTTCTCGAGAACCTCTATCACCTTTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000493.2-2066s1c1
Sequence:CCGGCCGAGTCAAATGGCCTATACTCTCGAGAGTATAGGCCATTTGACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000493.2-1954s1c1
Sequence:CCGGCCTGTAATGTACACCTATGATCTCGAGATCATAGGTGTACATTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000493.2-229s1c1
Sequence:CCGGCCCTACACCATAAAGAGTAAACTCGAGTTTACTCTTTATGGTGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009925
COL10A1 MISSION shRNA Bacterial Glycerol Stock
collagen, type X, alpha 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000092003    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009925.2-4268s1c1
Sequence:CCGGGCAGCGTAATATACAGGCTATCTCGAGATAGCCTGTATATTACGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009925.2-832s1c1
Sequence:CCGGCGCCATAAAGAGTAAAGGGATCTCGAGATCCCTTTACTCTTTATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009925.2-2440s1c1
Sequence:CCGGCGACCCAAGATCTGGTATCTTCTCGAGAAGATACCAGATCTTGGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009925.2-811s1c1
Sequence:CCGGGACACAATACTTCATCCCATACTCGAGTATGGGATGAAGTATTGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009925.2-2552s1c1
Sequence:CCGGCCTACGATGTACACGTATGATCTCGAGATCATACGTGTACATCGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009925
COL10A1 MISSION shRNA shRNA Plasmid DNA
collagen, type X, alpha 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000092003    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009925.2-4268s1c1
Sequence:CCGGGCAGCGTAATATACAGGCTATCTCGAGATAGCCTGTATATTACGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009925.2-832s1c1
Sequence:CCGGCGCCATAAAGAGTAAAGGGATCTCGAGATCCCTTTACTCTTTATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009925.2-2440s1c1
Sequence:CCGGCGACCCAAGATCTGGTATCTTCTCGAGAAGATACCAGATCTTGGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009925.2-811s1c1
Sequence:CCGGGACACAATACTTCATCCCATACTCGAGTATGGGATGAAGTATTGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009925.2-2552s1c1
Sequence:CCGGCCTACGATGTACACGTATGATCTCGAGATCATACGTGTACATCGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009925
COL10A1 MISSION shRNA Lentiviral Transduction Particles
collagen, type X, alpha 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000092003    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009925.2-4268s1c1
Sequence:CCGGGCAGCGTAATATACAGGCTATCTCGAGATAGCCTGTATATTACGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009925.2-832s1c1
Sequence:CCGGCGCCATAAAGAGTAAAGGGATCTCGAGATCCCTTTACTCTTTATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009925.2-2440s1c1
Sequence:CCGGCGACCCAAGATCTGGTATCTTCTCGAGAAGATACCAGATCTTGGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009925.2-811s1c1
Sequence:CCGGGACACAATACTTCATCCCATACTCGAGTATGGGATGAAGTATTGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009925.2-2552s1c1
Sequence:CCGGCCTACGATGTACACGTATGATCTCGAGATCATACGTGTACATCGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks