EMAIL THIS PAGE TO A FRIEND

COL11A1

collagen, type XI, alpha 1

181 Gene Product Result for
Synonyms: CO11A1 COLL6 STL2
Gene ID:
Human(1301) Summary: This gene encodes one of the two alpha chains of type XI collagen, a minor fibrillar collagen. Type XI collagen is a heterotrimer but the third alpha chain is a post-translationally modified alpha 1 type II chain. Mutations in this gene are associated with type II Stickler syndrome and with Marshall syndrome. A single-nucleotide polymorphism in this gene is also associated with susceptibility to lumbar disc herniation. Multiple transcript variants have been identified for this gene. [provided by RefSeq, Nov 2009]
Mouse(12814) collagen, type XI, alpha 1
Rat(25654) collagen, type XI, alpha 1
sheep(101117548) collagen, type XI, alpha 1
naked mole-rat(101700649) collagen, type XI, alpha 1
domestic guinea pig(100734025) collagen, type XI, alpha 1
chicken(374046) collagen, type XI, alpha 1
dog(100685969) collagen, type XI, alpha 1
domestic cat(101092628) collagen, type XI, alpha 1
cow(287013) collagen, type XI, alpha 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007729 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007729 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007729 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001854 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001854 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001854 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU028191 MISSION® esiRNA esiRNA targeting mouse Col11a1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001854 Rosetta Predictions human pricing
NM_080629 Rosetta Predictions human pricing
NM_080630 Rosetta Predictions human pricing
XM_001072431 Rosetta Predictions rat pricing
XM_001072520 Rosetta Predictions rat pricing
XM_001076840 Rosetta Predictions rat pricing
XM_342325 Rosetta Predictions rat pricing
NM_007729 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001854 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00031918 predicted 5116
2 SASI_Hs01_00031919 predicted 378
3 SASI_Hs02_00332673 predicted 873
4 SASI_Hs01_00031921 predicted 2430
5 SASI_Hs01_00031923 predicted 5389
6 SASI_Hs01_00031924 predicted 5480
7 SASI_Hs01_00031925 predicted 5543
8 SASI_Hs01_00031926 predicted 2517
9 SASI_Hs01_00031927 predicted 5310
10 SASI_Hs02_00332674 predicted 1562
11 SASI_Hs01_00031920 predicted 5378
12 SASI_Hs01_00031922 predicted 5624
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080629 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00241771 predicted 5154
2 SASI_Hs01_00241772 predicted 378
3 SASI_Hs02_00362374 predicted 875
4 SASI_Hs01_00241774 predicted 2471
5 SASI_Hs01_00241776 predicted 5419
6 SASI_Hs01_00241777 predicted 5517
7 SASI_Hs01_00241778 predicted 5575
8 SASI_Hs01_00241779 predicted 2557
9 SASI_Hs01_00241780 predicted 5341
10 SASI_Hs02_00362375 predicted 1591
11 SASI_Hs01_00241773 predicted 5417
12 SASI_Hs01_00241775 predicted 5652
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080630 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00205984 predicted 4997
2 SASI_Hs01_00205985 predicted 384
3 SASI_Hs02_00362376 predicted 869
4 SASI_Hs01_00205987 predicted 2314
5 SASI_Hs01_00205989 predicted 5264
6 SASI_Hs01_00205990 predicted 5358
7 SASI_Hs01_00205991 predicted 5419
8 SASI_Hs01_00205992 predicted 2404
9 SASI_Hs01_00205993 predicted 5188
10 SASI_Hs02_00362377 predicted 1445
11 SASI_Hs01_00205986 predicted 5258
12 SASI_Hs01_00205988 predicted 5497
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001072431 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00339143 predicted 620
2 SASI_Rn02_00339144 predicted 5625
3 SASI_Rn02_00339145 predicted 5458
4 SASI_Rn02_00339146 predicted 5419
5 SASI_Rn02_00339147 predicted 5354
6 SASI_Rn02_00339148 predicted 984
7 SASI_Rn02_00339149 predicted 3299
8 SASI_Rn02_00339150 predicted 5181
9 SASI_Rn02_00339151 predicted 5256
10 SASI_Rn02_00339152 predicted 1122
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001072520 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00339524 predicted 623
2 SASI_Rn02_00339525 predicted 5772
3 SASI_Rn02_00339526 predicted 5610
4 SASI_Rn02_00339527 predicted 5573
5 SASI_Rn02_00339528 predicted 5503
6 SASI_Rn02_00339529 predicted 990
7 SASI_Rn02_00339530 predicted 3445
8 SASI_Rn02_00339531 predicted 5332
9 SASI_Rn02_00339532 predicted 5411
10 SASI_Rn02_00339533 predicted 1116
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076840 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00354738 predicted 622
2 SASI_Rn02_00354739 predicted 5626
3 SASI_Rn02_00354740 predicted 5452
4 SASI_Rn02_00354741 predicted 5421
5 SASI_Rn02_00354742 predicted 5354
6 SASI_Rn02_00354743 predicted 989
7 SASI_Rn02_00354744 predicted 3293
8 SASI_Rn02_00354745 predicted 5185
9 SASI_Rn02_00354746 predicted 5256
10 SASI_Rn02_00354747 predicted 1117
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342325 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00394117 predicted 617
2 SASI_Rn02_00394118 predicted 5776
3 SASI_Rn02_00394119 predicted 5607
4 SASI_Rn02_00394120 predicted 5569
5 SASI_Rn02_00394121 predicted 5509
6 SASI_Rn02_00394122 predicted 992
7 SASI_Rn02_00394123 predicted 3447
8 SASI_Rn02_00394124 predicted 5332
9 SASI_Rn02_00394125 predicted 5411
10 SASI_Rn02_00394126 predicted 1122
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007729 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00197333 predicted 3356
2 SASI_Mm01_00197334 predicted 885
3 SASI_Mm01_00197335 predicted 5485
4 SASI_Mm01_00197336 predicted 5511
5 SASI_Mm02_00312319 predicted 935
6 SASI_Mm01_00197337 predicted 5019
7 SASI_Mm01_00197338 predicted 1078
8 SASI_Mm01_00197340 predicted 5524
9 SASI_Mm01_00197341 predicted 5242
10 SASI_Mm01_00197342 predicted 5578
11 SASI_Mm01_00197339 predicted 4906
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007729
VALIDATED
COL11A1 MISSION shRNA Bacterial Glycerol Stock
collagen, type XI, alpha 1
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000091193    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007729.1-5902s1c1
Sequence:CCGGCGTCCATCAAAGATATAGTAACTCGAGTTACTATATCTTTGATGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007729.1-4532s1c1
Sequence:CCGGCCTGGTTTAATTGGATTGATTCTCGAGAATCAATCCAATTAAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007729.1-3205s1c1
Sequence:CCGGGCCTCAAGGTATCTCAGGAAACTCGAGTTTCCTGAGATACCTTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007729.1-5321s1c1
Sequence:CCGGGCTGCCTGGTATGACGTATTACTCGAGTAATACGTCATACCAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007729.1-738s1c1
Sequence:CCGGCCCTCGATAGAAGTGAGAGATCTCGAGATCTCTCACTTCTATCGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007729.2-5294s21c1
Sequence:CCGGACATGCATCTATCCGGATAAACTCGAGTTTATCCGGATAGATGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007729.2-956s21c1
Sequence:CCGGACCAATGGAATCATGGTATTTCTCGAGAAATACCATGATTCCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007729.2-5549s21c1
Sequence:CCGGCTTCGATTTCTGGGATCAAATCTCGAGATTTGATCCCAGAAATCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366646    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007729.2-6234s21c1
Sequence:CCGGGTGGACTGTGACGGCAATAAACTCGAGTTTATTGCCGTCACAGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007729.2-5508s21c1
Sequence:CCGGCTGCCTGGTATGACGTATTATCTCGAGATAATACGTCATACCAGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007729.2-1134s21c1
Sequence:CCGGAGTATGCACCTGAGGATATAACTCGAGTTATATCCTCAGGTGCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007729.2-1380s21c1
Sequence:CCGGATCTAACCGGAGAGGATTATGCTCGAGCATAATCCTCTCCGGTTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377060    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007729.2-6096s21c1
Sequence:CCGGATCCATCAAAGATAGAGTAAACTCGAGTTTACTCTATCTTTGATGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007729
VALIDATED
COL11A1 MISSION shRNA shRNA Plasmid DNA
collagen, type XI, alpha 1
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000091193    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007729.1-5902s1c1
Sequence:CCGGCGTCCATCAAAGATATAGTAACTCGAGTTACTATATCTTTGATGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007729.1-4532s1c1
Sequence:CCGGCCTGGTTTAATTGGATTGATTCTCGAGAATCAATCCAATTAAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007729.1-3205s1c1
Sequence:CCGGGCCTCAAGGTATCTCAGGAAACTCGAGTTTCCTGAGATACCTTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007729.1-5321s1c1
Sequence:CCGGGCTGCCTGGTATGACGTATTACTCGAGTAATACGTCATACCAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007729.1-738s1c1
Sequence:CCGGCCCTCGATAGAAGTGAGAGATCTCGAGATCTCTCACTTCTATCGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007729.2-5294s21c1
Sequence:CCGGACATGCATCTATCCGGATAAACTCGAGTTTATCCGGATAGATGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007729.2-956s21c1
Sequence:CCGGACCAATGGAATCATGGTATTTCTCGAGAAATACCATGATTCCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007729.2-5549s21c1
Sequence:CCGGCTTCGATTTCTGGGATCAAATCTCGAGATTTGATCCCAGAAATCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366646    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007729.2-6234s21c1
Sequence:CCGGGTGGACTGTGACGGCAATAAACTCGAGTTTATTGCCGTCACAGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007729.2-5508s21c1
Sequence:CCGGCTGCCTGGTATGACGTATTATCTCGAGATAATACGTCATACCAGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007729.2-1134s21c1
Sequence:CCGGAGTATGCACCTGAGGATATAACTCGAGTTATATCCTCAGGTGCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007729.2-1380s21c1
Sequence:CCGGATCTAACCGGAGAGGATTATGCTCGAGCATAATCCTCTCCGGTTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377060    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007729.2-6096s21c1
Sequence:CCGGATCCATCAAAGATAGAGTAAACTCGAGTTTACTCTATCTTTGATGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007729
VALIDATED
COL11A1 MISSION shRNA Lentiviral Transduction Particles
collagen, type XI, alpha 1
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000091193    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007729.1-5902s1c1
Sequence:CCGGCGTCCATCAAAGATATAGTAACTCGAGTTACTATATCTTTGATGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007729.1-4532s1c1
Sequence:CCGGCCTGGTTTAATTGGATTGATTCTCGAGAATCAATCCAATTAAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007729.1-3205s1c1
Sequence:CCGGGCCTCAAGGTATCTCAGGAAACTCGAGTTTCCTGAGATACCTTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007729.1-5321s1c1
Sequence:CCGGGCTGCCTGGTATGACGTATTACTCGAGTAATACGTCATACCAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007729.1-738s1c1
Sequence:CCGGCCCTCGATAGAAGTGAGAGATCTCGAGATCTCTCACTTCTATCGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007729.2-5294s21c1
Sequence:CCGGACATGCATCTATCCGGATAAACTCGAGTTTATCCGGATAGATGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007729.2-956s21c1
Sequence:CCGGACCAATGGAATCATGGTATTTCTCGAGAAATACCATGATTCCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007729.2-5549s21c1
Sequence:CCGGCTTCGATTTCTGGGATCAAATCTCGAGATTTGATCCCAGAAATCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366646    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007729.2-6234s21c1
Sequence:CCGGGTGGACTGTGACGGCAATAAACTCGAGTTTATTGCCGTCACAGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007729.2-5508s21c1
Sequence:CCGGCTGCCTGGTATGACGTATTATCTCGAGATAATACGTCATACCAGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007729.2-1134s21c1
Sequence:CCGGAGTATGCACCTGAGGATATAACTCGAGTTATATCCTCAGGTGCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007729.2-1380s21c1
Sequence:CCGGATCTAACCGGAGAGGATTATGCTCGAGCATAATCCTCTCCGGTTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377060    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007729.2-6096s21c1
Sequence:CCGGATCCATCAAAGATAGAGTAAACTCGAGTTTACTCTATCTTTGATGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001854
COL11A1 MISSION shRNA Bacterial Glycerol Stock
collagen, type XI, alpha 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000083374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001854.2-1783s1c1
Sequence:CCGGCCTGGTACTATGTTGATGTTACTCGAGTAACATCAACATAGTACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001854.2-4681s1c1
Sequence:CCGGCCTGGTTTAATTGGCCTGATTCTCGAGAATCAGGCCAATTAAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001854.2-875s1c1
Sequence:CCGGCCACGAAACCACTTGATAGAACTCGAGTTCTATCAAGTGGTTTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001854.2-3355s1c1
Sequence:CCGGCCTCAAGGTATCTCAGGGAAACTCGAGTTTCCCTGAGATACCTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083373    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001854.2-5975s1c1
Sequence:CCGGCCCAATTCTCAACTCTCCTTTCTCGAGAAAGGAGAGTTGAGAATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001854.3-1097s21c1
Sequence:CCGGAGTATGCACCAGAGGATATAACTCGAGTTATATCCTCTGGTGCATACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001854
COL11A1 MISSION shRNA shRNA Plasmid DNA
collagen, type XI, alpha 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000083374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001854.2-1783s1c1
Sequence:CCGGCCTGGTACTATGTTGATGTTACTCGAGTAACATCAACATAGTACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001854.2-4681s1c1
Sequence:CCGGCCTGGTTTAATTGGCCTGATTCTCGAGAATCAGGCCAATTAAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001854.2-875s1c1
Sequence:CCGGCCACGAAACCACTTGATAGAACTCGAGTTCTATCAAGTGGTTTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001854.2-3355s1c1
Sequence:CCGGCCTCAAGGTATCTCAGGGAAACTCGAGTTTCCCTGAGATACCTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083373    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001854.2-5975s1c1
Sequence:CCGGCCCAATTCTCAACTCTCCTTTCTCGAGAAAGGAGAGTTGAGAATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001854.3-1097s21c1
Sequence:CCGGAGTATGCACCAGAGGATATAACTCGAGTTATATCCTCTGGTGCATACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001854
COL11A1 MISSION shRNA Lentiviral Transduction Particles
collagen, type XI, alpha 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000083374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001854.2-1783s1c1
Sequence:CCGGCCTGGTACTATGTTGATGTTACTCGAGTAACATCAACATAGTACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001854.2-4681s1c1
Sequence:CCGGCCTGGTTTAATTGGCCTGATTCTCGAGAATCAGGCCAATTAAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001854.2-875s1c1
Sequence:CCGGCCACGAAACCACTTGATAGAACTCGAGTTCTATCAAGTGGTTTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001854.2-3355s1c1
Sequence:CCGGCCTCAAGGTATCTCAGGGAAACTCGAGTTTCCCTGAGATACCTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083373    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001854.2-5975s1c1
Sequence:CCGGCCCAATTCTCAACTCTCCTTTCTCGAGAAAGGAGAGTTGAGAATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001854.3-1097s21c1
Sequence:CCGGAGTATGCACCAGAGGATATAACTCGAGTTATATCCTCTGGTGCATACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks