EMAIL THIS PAGE TO A FRIEND

COL11A2

collagen, type XI, alpha 2

140 Gene Product Result for
Synonyms: DFNA13 DFNB53 FBCG2 HKE5 PARP STL3
Gene ID:
Human(1302) Summary: This gene encodes one of the two alpha chains of type XI collagen, a minor fibrillar collagen. It is located on chromosome 6 very close to but separate from the gene for retinoid X receptor beta. Type XI collagen is a heterotrimer but the third alpha chain is a post-translationally modified alpha 1 type II chain. Proteolytic processing of this type XI chain produces PARP, a proline/arginine-rich protein that is an amino terminal domain. Mutations in this gene are associated with type III Stickler syndrome, otospondylomegaepiphyseal dysplasia (OSMED syndrome), Weissenbacher-Zweymuller syndrome, autosomal dominant non-syndromic sensorineural type 13 deafness (DFNA13), and autosomal recessive non-syndromic sensorineural type 53 deafness (DFNB53). Alternative splicing results in multiple transcript variants. A related pseudogene is located nearby on chromosome 6. [provided by RefSeq, Jul 2009]
Mouse(12815) collagen, type XI, alpha 2
Rat(294279) collagen, type XI, alpha 2
Zebrafish(561679) collagen type XI alpha-2
cow(515435) collagen, type XI, alpha 2
Horse(100061226) collagen, type XI, alpha 2
domestic cat(101085209) collagen, type XI, alpha 2
dog(481734) collagen, type XI, alpha 2
domestic guinea pig(100733245) collagen, type XI, alpha 2
naked mole-rat(101726497) collagen, type XI, alpha 2
sheep(101116356) collagen, type XI, alpha 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080679 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080679 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080679 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009926 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009926 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009926 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_080679 Rosetta Predictions human pricing
NM_080680 Rosetta Predictions human pricing
NM_080681 Rosetta Predictions human pricing
NM_212528 Rosetta Predictions rat pricing
NM_009926 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080679 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00160253 predicted 4942
2 SASI_Hs01_00160254 predicted 4418
3 SASI_Hs01_00160255 predicted 791
4 SASI_Hs01_00160256 predicted 688
5 SASI_Hs01_00160257 predicted 5409
6 SASI_Hs01_00160258 predicted 714
7 SASI_Hs02_00362458 predicted 4462
8 SASI_Hs01_00160259 predicted 1247
9 SASI_Hs01_00160260 predicted 468
10 SASI_Hs01_00160262 predicted 1422
11 SASI_Hs01_00160261 predicted 792
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080680 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00044297 predicted 5262
2 SASI_Hs01_00044298 predicted 4739
3 SASI_Hs01_00044299 predicted 788
4 SASI_Hs01_00044300 predicted 690
5 SASI_Hs01_00044301 predicted 5735
6 SASI_Hs01_00044302 predicted 705
7 SASI_Hs02_00362459 predicted 4783
8 SASI_Hs01_00044303 predicted 1564
9 SASI_Hs01_00044304 predicted 462
10 SASI_Hs01_00044306 predicted 1751
11 SASI_Hs01_00044305 predicted 790
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080681 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00194683 predicted 5007
2 SASI_Hs01_00194684 predicted 4477
3 SASI_Hs01_00194685 predicted 786
4 SASI_Hs01_00194686 predicted 686
5 SASI_Hs01_00194687 predicted 5472
6 SASI_Hs01_00194688 predicted 713
7 SASI_Hs02_00362460 predicted 4522
8 SASI_Hs01_00194689 predicted 1305
9 SASI_Hs01_00194690 predicted 464
10 SASI_Hs01_00194692 predicted 1487
11 SASI_Hs01_00194691 predicted 793
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_212528 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00117952 predicted 1792
2 SASI_Rn01_00117953 predicted 2281
3 SASI_Rn01_00117954 predicted 4406
4 SASI_Rn01_00117955 predicted 1787
5 SASI_Rn01_00117956 predicted 4704
6 SASI_Rn01_00117957 predicted 689
7 SASI_Rn01_00117958 predicted 689
8 SASI_Rn01_00117959 predicted 4711
9 SASI_Rn01_00117960 predicted 853
10 SASI_Rn01_00117961 predicted 1474
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009926 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00186455 predicted 3529
2 SASI_Mm01_00186456 predicted 3378
3 SASI_Mm01_00186457 predicted 1798
4 SASI_Mm01_00186459 predicted 673
5 SASI_Mm02_00317468 predicted 459
6 SASI_Mm01_00186460 predicted 1482
7 SASI_Mm01_00186461 predicted 2523
8 SASI_Mm01_00186462 predicted 891
9 SASI_Mm01_00186463 predicted 958
10 SASI_Mm01_00186464 predicted 695
11 SASI_Mm01_00186458 predicted 1299
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080679
COL11A2 MISSION shRNA Bacterial Glycerol Stock
collagen, type XI, alpha 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433437    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080679.2-5355s21c1
Sequence:CCGGGAGAGCTGAGACCCTTATTTACTCGAGTAAATAAGGGTCTCAGCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080679.2-460s21c1
Sequence:CCGGGGAGGATTTCCCAAAGATTTCCTCGAGGAAATCTTTGGGAAATCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080679.2-756s21c1
Sequence:CCGGCCGAAGTGCTCGTCCAGTATTCTCGAGAATACTGGACGAGCACTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080679.2-781s21c1
Sequence:CCGGACCCATGGAGTGATCATCTTTCTCGAGAAAGATGATCACTCCATGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083068    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080679.1-5651s1c1
Sequence:CCGGCCACTGTGAAAGTTGGAATATCTCGAGATATTCCAACTTTCACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080679.1-4139s1c1
Sequence:CCGGCCCAGGTCTCATTGGACTGATCTCGAGATCAGTCCAATGAGACCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080679.1-3325s1c1
Sequence:CCGGGTGATGAAGGAACAAGAGGATCTCGAGATCCTCTTGTTCCTTCATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080679.1-870s1c1
Sequence:CCGGGCAGCCTATGAATCATGTGAACTCGAGTTCACATGATTCATAGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080679.1-801s1c1
Sequence:CCGGGCCCGTATTCTGGATGAAGAACTCGAGTTCTTCATCCAGAATACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080679
COL11A2 MISSION shRNA shRNA Plasmid DNA
collagen, type XI, alpha 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433437    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080679.2-5355s21c1
Sequence:CCGGGAGAGCTGAGACCCTTATTTACTCGAGTAAATAAGGGTCTCAGCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080679.2-460s21c1
Sequence:CCGGGGAGGATTTCCCAAAGATTTCCTCGAGGAAATCTTTGGGAAATCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080679.2-756s21c1
Sequence:CCGGCCGAAGTGCTCGTCCAGTATTCTCGAGAATACTGGACGAGCACTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080679.2-781s21c1
Sequence:CCGGACCCATGGAGTGATCATCTTTCTCGAGAAAGATGATCACTCCATGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083068    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080679.1-5651s1c1
Sequence:CCGGCCACTGTGAAAGTTGGAATATCTCGAGATATTCCAACTTTCACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080679.1-4139s1c1
Sequence:CCGGCCCAGGTCTCATTGGACTGATCTCGAGATCAGTCCAATGAGACCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080679.1-3325s1c1
Sequence:CCGGGTGATGAAGGAACAAGAGGATCTCGAGATCCTCTTGTTCCTTCATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080679.1-870s1c1
Sequence:CCGGGCAGCCTATGAATCATGTGAACTCGAGTTCACATGATTCATAGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080679.1-801s1c1
Sequence:CCGGGCCCGTATTCTGGATGAAGAACTCGAGTTCTTCATCCAGAATACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080679
COL11A2 MISSION shRNA Lentiviral Transduction Particles
collagen, type XI, alpha 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433437    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080679.2-5355s21c1
Sequence:CCGGGAGAGCTGAGACCCTTATTTACTCGAGTAAATAAGGGTCTCAGCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080679.2-460s21c1
Sequence:CCGGGGAGGATTTCCCAAAGATTTCCTCGAGGAAATCTTTGGGAAATCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080679.2-756s21c1
Sequence:CCGGCCGAAGTGCTCGTCCAGTATTCTCGAGAATACTGGACGAGCACTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080679.2-781s21c1
Sequence:CCGGACCCATGGAGTGATCATCTTTCTCGAGAAAGATGATCACTCCATGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083068    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080679.1-5651s1c1
Sequence:CCGGCCACTGTGAAAGTTGGAATATCTCGAGATATTCCAACTTTCACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080679.1-4139s1c1
Sequence:CCGGCCCAGGTCTCATTGGACTGATCTCGAGATCAGTCCAATGAGACCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080679.1-3325s1c1
Sequence:CCGGGTGATGAAGGAACAAGAGGATCTCGAGATCCTCTTGTTCCTTCATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080679.1-870s1c1
Sequence:CCGGGCAGCCTATGAATCATGTGAACTCGAGTTCACATGATTCATAGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080679.1-801s1c1
Sequence:CCGGGCCCGTATTCTGGATGAAGAACTCGAGTTCTTCATCCAGAATACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009926
COL11A2 MISSION shRNA Bacterial Glycerol Stock
collagen, type XI, alpha 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000091808    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009926.1-5440s1c1
Sequence:CCGGCCCAAATAAGTGGAAGAGAAACTCGAGTTTCTCTTCCACTTATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009926.1-2955s1c1
Sequence:CCGGCCCGGCTTGAAAGGAAATGAACTCGAGTTCATTTCCTTTCAAGCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009926.1-350s1c1
Sequence:CCGGCGATGGTGTTCGGAGATCAAACTCGAGTTTGATCTCCGAACACCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009926.1-4994s1c1
Sequence:CCGGCAGCCCTTATGTCAAGGAGTTCTCGAGAACTCCTTGACATAAGGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009926.1-869s1c1
Sequence:CCGGCTATCAGTCTTGTGGGCAGAACTCGAGTTCTGCCCACAAGACTGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009926
COL11A2 MISSION shRNA shRNA Plasmid DNA
collagen, type XI, alpha 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000091808    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009926.1-5440s1c1
Sequence:CCGGCCCAAATAAGTGGAAGAGAAACTCGAGTTTCTCTTCCACTTATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009926.1-2955s1c1
Sequence:CCGGCCCGGCTTGAAAGGAAATGAACTCGAGTTCATTTCCTTTCAAGCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009926.1-350s1c1
Sequence:CCGGCGATGGTGTTCGGAGATCAAACTCGAGTTTGATCTCCGAACACCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009926.1-4994s1c1
Sequence:CCGGCAGCCCTTATGTCAAGGAGTTCTCGAGAACTCCTTGACATAAGGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009926.1-869s1c1
Sequence:CCGGCTATCAGTCTTGTGGGCAGAACTCGAGTTCTGCCCACAAGACTGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009926
COL11A2 MISSION shRNA Lentiviral Transduction Particles
collagen, type XI, alpha 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000091808    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009926.1-5440s1c1
Sequence:CCGGCCCAAATAAGTGGAAGAGAAACTCGAGTTTCTCTTCCACTTATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009926.1-2955s1c1
Sequence:CCGGCCCGGCTTGAAAGGAAATGAACTCGAGTTCATTTCCTTTCAAGCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009926.1-350s1c1
Sequence:CCGGCGATGGTGTTCGGAGATCAAACTCGAGTTTGATCTCCGAACACCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009926.1-4994s1c1
Sequence:CCGGCAGCCCTTATGTCAAGGAGTTCTCGAGAACTCCTTGACATAAGGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009926.1-869s1c1
Sequence:CCGGCTATCAGTCTTGTGGGCAGAACTCGAGTTCTGCCCACAAGACTGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks