EMAIL THIS PAGE TO A FRIEND

COL12A1

collagen, type XII, alpha 1

203 Gene Product Result for
Synonyms: BA209D8.1 COL12A1L DJ234P15.1
Gene ID:
Human(1303) Summary: This gene encodes the alpha chain of type XII collagen, a member of the FACIT (fibril-associated collagens with interrupted triple helices) collagen family. Type XII collagen is a homotrimer found in association with type I collagen, an association that is thought to modify the interactions between collagen I fibrils and the surrounding matrix. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Mouse(12816) collagen, type XII, alpha 1
Rat(25683) collagen, type XII, alpha 1
chicken(395875) collagen, type XII, alpha 1
dog(481881) collagen, type XII, alpha 1
Horse(100033858) collagen, type XII, alpha 1
cow(359712) collagen, type XII, alpha 1
domestic cat(101093359) collagen, type XII, alpha 1
sheep(101109808) collagen, type XII, alpha 1
Domestic Rabbit(100009174) collagen, type XII, alpha 1
domestic guinea pig(100721468) collagen, type XII, alpha 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007730 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007730 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007730 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004370 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004370 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004370 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU066591 MISSION® esiRNA esiRNA human COL12A1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004370 Rosetta Predictions human pricing
NM_080645 Rosetta Predictions human pricing
XM_001060689 Rosetta Predictions rat pricing
XM_243912 Rosetta Predictions rat pricing
NM_007730 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004370 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00027196 predicted 5688
2 SASI_Hs02_00337442 predicted 6255
3 SASI_Hs01_00027198 predicted 7823
4 SASI_Hs01_00027199 predicted 4940
5 SASI_Hs02_00337443 predicted 6757
6 SASI_Hs01_00027202 predicted 5613
7 SASI_Hs02_00337444 predicted 9334
8 SASI_Hs01_00027203 predicted 6243
9 SASI_Hs02_00337445 predicted 6043
10 SASI_Hs01_00027204 predicted 9432
11 SASI_Hs01_00027197 predicted 5155
12 SASI_Hs01_00027200 predicted 5323
13 SASI_Hs01_00027201 predicted 5351
14 SASI_Hs01_00027205 predicted 5894
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080645 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00223993 predicted 2197
2 SASI_Hs02_00362384 predicted 2764
3 SASI_Hs01_00223995 predicted 4330
4 SASI_Hs01_00223996 predicted 1451
5 SASI_Hs02_00362385 predicted 3258
6 SASI_Hs01_00223999 predicted 2119
7 SASI_Hs02_00362386 predicted 5841
8 SASI_Hs01_00224000 predicted 2747
9 SASI_Hs02_00362387 predicted 2554
10 SASI_Hs01_00224001 predicted 5940
11 SASI_Hs01_00223994 predicted 1669
12 SASI_Hs01_00223997 predicted 1825
13 SASI_Hs01_00223998 predicted 1857
14 SASI_Hs01_00224002 predicted 2392
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001060689 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00297382 predicted 4677
2 SASI_Rn02_00297383 predicted 3575
3 SASI_Rn02_00297384 predicted 568
4 SASI_Rn02_00297385 predicted 9126
5 SASI_Rn02_00297386 predicted 2313
6 SASI_Rn02_00297387 predicted 3134
7 SASI_Rn02_00297388 predicted 6643
8 SASI_Rn02_00297389 predicted 5895
9 SASI_Rn02_00297390 predicted 3396
10 SASI_Rn02_00297391 predicted 6868
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_243912 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00391789 predicted 4388
2 SASI_Rn02_00391790 predicted 3286
3 SASI_Rn02_00391791 predicted 282
4 SASI_Rn02_00391792 predicted 8837
5 SASI_Rn02_00391793 predicted 2022
6 SASI_Rn02_00391794 predicted 2851
7 SASI_Rn02_00391795 predicted 6360
8 SASI_Rn02_00391796 predicted 5612
9 SASI_Rn02_00391797 predicted 3113
10 SASI_Rn02_00391798 predicted 6575
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007730 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00101366 predicted 4530
2 SASI_Mm02_00312320 predicted 3536
3 SASI_Mm02_00312321 predicted 1010
4 SASI_Mm01_00101369 predicted 6609
5 SASI_Mm01_00101370 predicted 554
6 SASI_Mm02_00312322 predicted 8341
7 SASI_Mm01_00101371 predicted 3095
8 SASI_Mm01_00101372 predicted 474
9 SASI_Mm01_00101373 predicted 2205
10 SASI_Mm01_00101374 predicted 1996
11 SASI_Mm01_00101367 predicted 357
12 SASI_Mm01_00101368 predicted 810
13 SASI_Mm01_00101375 predicted 5555
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007730
COL12A1 MISSION shRNA Bacterial Glycerol Stock
collagen, type XII, alpha 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000091113    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007730.1-9449s1c1
Sequence:CCGGCCCTCCTGTATTTCTGGATTTCTCGAGAAATCCAGAAATACAGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007730.1-7653s1c1
Sequence:CCGGCCAGGCTTTAAGATGCTTGAACTCGAGTTCAAGCATCTTAAAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007730.1-2355s1c1
Sequence:CCGGCGGATTAGATACAGACCAGTTCTCGAGAACTGGTCTGTATCTAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007730.1-8127s1c1
Sequence:CCGGGCTGGAAATATAACAACTGATCTCGAGATCAGTTGTTATATTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007730.1-4254s1c1
Sequence:CCGGGCACCGACTAACTTAGTAATTCTCGAGAATTACTAAGTTAGTCGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348536    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007730.2-9755s21c1
Sequence:CCGGTGTGAAGGAGGCGCCTAATAACTCGAGTTATTAGGCGCCTCCTTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007730.2-8330s21c1
Sequence:CCGGGCTGGAAATATAACAACTGATCTCGAGATCAGTTGTTATATTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007730.2-4454s21c1
Sequence:CCGGGCACCGACTAACTTAGTAATTCTCGAGAATTACTAAGTTAGTCGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007730.2-2555s21c1
Sequence:CCGGCGGATTAGATACAGACCAGTTCTCGAGAACTGGTCTGTATCTAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007730
COL12A1 MISSION shRNA shRNA Plasmid DNA
collagen, type XII, alpha 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000091113    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007730.1-9449s1c1
Sequence:CCGGCCCTCCTGTATTTCTGGATTTCTCGAGAAATCCAGAAATACAGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007730.1-7653s1c1
Sequence:CCGGCCAGGCTTTAAGATGCTTGAACTCGAGTTCAAGCATCTTAAAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007730.1-2355s1c1
Sequence:CCGGCGGATTAGATACAGACCAGTTCTCGAGAACTGGTCTGTATCTAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007730.1-8127s1c1
Sequence:CCGGGCTGGAAATATAACAACTGATCTCGAGATCAGTTGTTATATTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007730.1-4254s1c1
Sequence:CCGGGCACCGACTAACTTAGTAATTCTCGAGAATTACTAAGTTAGTCGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348536    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007730.2-9755s21c1
Sequence:CCGGTGTGAAGGAGGCGCCTAATAACTCGAGTTATTAGGCGCCTCCTTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007730.2-8330s21c1
Sequence:CCGGGCTGGAAATATAACAACTGATCTCGAGATCAGTTGTTATATTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007730.2-4454s21c1
Sequence:CCGGGCACCGACTAACTTAGTAATTCTCGAGAATTACTAAGTTAGTCGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007730.2-2555s21c1
Sequence:CCGGCGGATTAGATACAGACCAGTTCTCGAGAACTGGTCTGTATCTAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007730
COL12A1 MISSION shRNA Lentiviral Transduction Particles
collagen, type XII, alpha 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000091113    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007730.1-9449s1c1
Sequence:CCGGCCCTCCTGTATTTCTGGATTTCTCGAGAAATCCAGAAATACAGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007730.1-7653s1c1
Sequence:CCGGCCAGGCTTTAAGATGCTTGAACTCGAGTTCAAGCATCTTAAAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007730.1-2355s1c1
Sequence:CCGGCGGATTAGATACAGACCAGTTCTCGAGAACTGGTCTGTATCTAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007730.1-8127s1c1
Sequence:CCGGGCTGGAAATATAACAACTGATCTCGAGATCAGTTGTTATATTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007730.1-4254s1c1
Sequence:CCGGGCACCGACTAACTTAGTAATTCTCGAGAATTACTAAGTTAGTCGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348536    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007730.2-9755s21c1
Sequence:CCGGTGTGAAGGAGGCGCCTAATAACTCGAGTTATTAGGCGCCTCCTTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007730.2-8330s21c1
Sequence:CCGGGCTGGAAATATAACAACTGATCTCGAGATCAGTTGTTATATTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007730.2-4454s21c1
Sequence:CCGGGCACCGACTAACTTAGTAATTCTCGAGAATTACTAAGTTAGTCGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007730.2-2555s21c1
Sequence:CCGGCGGATTAGATACAGACCAGTTCTCGAGAACTGGTCTGTATCTAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004370
VALIDATED
COL12A1 MISSION shRNA Bacterial Glycerol Stock
collagen, type XII, alpha 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000108410    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004370.4-10248s1c1
Sequence:CCGGCCCAAGTATTTGTGCAATGATCTCGAGATCATTGCACAAATACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004370.4-7832s1c1
Sequence:CCGGCCCTCCTTCATACACGATTATCTCGAGATAATCGTGTATGAAGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004370.4-5453s1c1
Sequence:CCGGGCAGAAATATAGGATCACTTACTCGAGTAAGTGATCCTATATTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004370.4-1963s1c1
Sequence:CCGGGCCTTAGAATTGAGCAAGAATCTCGAGATTCTTGCTCAATTCTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004370.4-7833s1c1
Sequence:CCGGCCTCCTTCATACACGATTATACTCGAGTATAATCGTGTATGAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004370
VALIDATED
COL12A1 MISSION shRNA shRNA Plasmid DNA
collagen, type XII, alpha 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000108410    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004370.4-10248s1c1
Sequence:CCGGCCCAAGTATTTGTGCAATGATCTCGAGATCATTGCACAAATACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004370.4-7832s1c1
Sequence:CCGGCCCTCCTTCATACACGATTATCTCGAGATAATCGTGTATGAAGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004370.4-5453s1c1
Sequence:CCGGGCAGAAATATAGGATCACTTACTCGAGTAAGTGATCCTATATTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004370.4-1963s1c1
Sequence:CCGGGCCTTAGAATTGAGCAAGAATCTCGAGATTCTTGCTCAATTCTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004370.4-7833s1c1
Sequence:CCGGCCTCCTTCATACACGATTATACTCGAGTATAATCGTGTATGAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004370
VALIDATED
COL12A1 MISSION shRNA Lentiviral Transduction Particles
collagen, type XII, alpha 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000108410    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004370.4-10248s1c1
Sequence:CCGGCCCAAGTATTTGTGCAATGATCTCGAGATCATTGCACAAATACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004370.4-7832s1c1
Sequence:CCGGCCCTCCTTCATACACGATTATCTCGAGATAATCGTGTATGAAGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004370.4-5453s1c1
Sequence:CCGGGCAGAAATATAGGATCACTTACTCGAGTAAGTGATCCTATATTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004370.4-1963s1c1
Sequence:CCGGGCCTTAGAATTGAGCAAGAATCTCGAGATTCTTGCTCAATTCTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004370.4-7833s1c1
Sequence:CCGGCCTCCTTCATACACGATTATACTCGAGTATAATCGTGTATGAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks