EMAIL THIS PAGE TO A FRIEND

COL13A1

collagen, type XIII, alpha 1

281 Gene Product Result for
Synonyms: COLXIIIA1
Gene ID:
Human(1305) Summary: This gene encodes the alpha chain of one of the nonfibrillar collagens. The function of this gene product is not known, however, it has been detected at low levels in all connective tissue-producing cells so it may serve a general function in connective tissues. Unlike most of the collagens, which are secreted into the extracellular matrix, collagen XIII contains a transmembrane domain and the protein has been localized to the plasma membrane. The transcripts for this gene undergo complex and extensive splicing involving at least eight exons. Like other collagens, collagen XIII is a trimer; it is not known whether this trimer is composed of one or more than one alpha chain isomer. A number of alternatively spliced transcript variants have been described, but the full length nature of some of them has not been determined. [provided by RefSeq, Jul 2008]
Mouse(12817) collagen, type XIII, alpha 1
Rat(499431) collagen, type XIII, alpha 1
chicken(769037) collagen, type XIII, alpha 1
cow(613849) collagen, type XIII, alpha 1
Horse(100072695) collagen, type XIII, alpha 1
domestic cat(101098656) collagen, type XIII, alpha 1
dog(609516) collagen, type XIII, alpha 1
domestic guinea pig(100720893) collagen, type XIII, alpha 1
naked mole-rat(101710784) collagen, type XIII, alpha 1
sheep(101105550) collagen, type XIII, alpha 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007731 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007731 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007731 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_080812 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080812 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080812 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005203 Rosetta Predictions human pricing
NM_080798 Rosetta Predictions human pricing
NM_080799 Rosetta Predictions human pricing
NM_080800 Rosetta Predictions human pricing
NM_080801 Rosetta Predictions human pricing
NM_080802 Rosetta Predictions human pricing
NM_080803 Rosetta Predictions human pricing
NM_080804 Rosetta Predictions human pricing
NM_080805 Rosetta Predictions human pricing
NM_080806 Rosetta Predictions human pricing
NM_080807 Rosetta Predictions human pricing
NM_080808 Rosetta Predictions human pricing
NM_080809 Rosetta Predictions human pricing
NM_080810 Rosetta Predictions human pricing
NM_080811 Rosetta Predictions human pricing
NM_080812 Rosetta Predictions human pricing
NM_080813 Rosetta Predictions human pricing
NM_080814 Rosetta Predictions human pricing
NM_080815 Rosetta Predictions human pricing
NM_001109172 Rosetta Predictions rat pricing
NM_007731 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005203 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00149848 predicted 1857
2 SASI_Hs01_00149849 predicted 2876
3 SASI_Hs01_00149850 predicted 1864
4 SASI_Hs01_00149851 predicted 2879
5 SASI_Hs01_00149852 predicted 1864
6 SASI_Hs01_00149853 predicted 2909
7 SASI_Hs01_00149854 predicted 2901
8 SASI_Hs01_00149855 predicted 1540
9 SASI_Hs02_00339172 predicted 1840
10 SASI_Hs01_00149856 predicted 1879
11 SASI_Hs01_00149857 predicted 1932
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080798 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00117758 predicted 1825
2 SASI_Hs01_00117759 predicted 2836
3 SASI_Hs01_00117760 predicted 1826
4 SASI_Hs01_00117761 predicted 2842
5 SASI_Hs01_00117762 predicted 1824
6 SASI_Hs01_00117763 predicted 2873
7 SASI_Hs01_00117764 predicted 2873
8 SASI_Hs01_00117765 predicted 1504
9 SASI_Hs02_00362564 predicted 1797
10 SASI_Hs01_00117766 predicted 1844
11 SASI_Hs01_00117767 predicted 1895
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080799 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00165886 predicted 1804
2 SASI_Hs01_00165887 predicted 2827
3 SASI_Hs01_00165888 predicted 1811
4 SASI_Hs01_00165889 predicted 2821
5 SASI_Hs01_00165890 predicted 1813
6 SASI_Hs01_00165891 predicted 2856
7 SASI_Hs01_00165892 predicted 2858
8 SASI_Hs01_00165893 predicted 1484
9 SASI_Hs02_00362565 predicted 1789
10 SASI_Hs01_00165894 predicted 1827
11 SASI_Hs01_00165895 predicted 1877
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080800 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00111308 predicted 1803
2 SASI_Hs01_00111309 predicted 2817
3 SASI_Hs01_00111310 predicted 1810
4 SASI_Hs01_00111311 predicted 2824
5 SASI_Hs01_00111312 predicted 1811
6 SASI_Hs01_00111313 predicted 2845
7 SASI_Hs01_00111314 predicted 2845
8 SASI_Hs01_00111315 predicted 1480
9 SASI_Hs02_00362566 predicted 1777
10 SASI_Hs01_00111316 predicted 1828
11 SASI_Hs01_00111317 predicted 1872
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080801 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00146862 predicted 1795
2 SASI_Hs01_00146863 predicted 2813
3 SASI_Hs01_00146864 predicted 1794
4 SASI_Hs01_00146865 predicted 2808
5 SASI_Hs01_00146866 predicted 1794
6 SASI_Hs01_00146867 predicted 2839
7 SASI_Hs01_00146868 predicted 2842
8 SASI_Hs01_00146869 predicted 1475
9 SASI_Hs02_00362567 predicted 1774
10 SASI_Hs01_00146870 predicted 1812
11 SASI_Hs01_00146871 predicted 1872
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080802 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00198956 predicted 1859
2 SASI_Hs01_00198957 predicted 2827
3 SASI_Hs01_00198958 predicted 1863
4 SASI_Hs01_00198959 predicted 2829
5 SASI_Hs01_00198960 predicted 1861
6 SASI_Hs01_00198961 predicted 2866
7 SASI_Hs01_00198962 predicted 2856
8 SASI_Hs01_00198963 predicted 1534
9 SASI_Hs02_00362568 predicted 1838
10 SASI_Hs01_00198964 predicted 1878
11 SASI_Hs01_00198965 predicted 1931
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080803 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00076439 predicted 1854
2 SASI_Hs01_00076440 predicted 2835
3 SASI_Hs01_00076441 predicted 1864
4 SASI_Hs01_00076442 predicted 2832
5 SASI_Hs01_00076443 predicted 1864
6 SASI_Hs01_00076444 predicted 2861
7 SASI_Hs01_00076445 predicted 2859
8 SASI_Hs01_00076446 predicted 1534
9 SASI_Hs02_00362569 predicted 1831
10 SASI_Hs01_00076447 predicted 1880
11 SASI_Hs01_00076448 predicted 1929
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080804 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00235326 predicted 1860
2 SASI_Hs01_00235327 predicted 2837
3 SASI_Hs01_00235328 predicted 1865
4 SASI_Hs01_00235329 predicted 2838
5 SASI_Hs01_00235330 predicted 1862
6 SASI_Hs01_00235331 predicted 2875
7 SASI_Hs01_00235332 predicted 2866
8 SASI_Hs01_00235333 predicted 1534
9 SASI_Hs02_00362570 predicted 1838
10 SASI_Hs01_00235334 predicted 1882
11 SASI_Hs01_00235335 predicted 1934
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080805 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00168022 predicted 1772
2 SASI_Hs02_00362571 predicted 2786
3 SASI_Hs01_00168023 predicted 1775
4 SASI_Hs02_00362572 predicted 2789
5 SASI_Hs01_00168024 predicted 1779
6 SASI_Hs02_00362573 predicted 2823
7 SASI_Hs02_00362574 predicted 2819
8 SASI_Hs01_00168025 predicted 1448
9 SASI_Hs01_00168026 predicted 1747
10 SASI_Hs01_00168027 predicted 1793
11 SASI_Hs01_00168028 predicted 1845
12 SASI_Hs01_00168029 predicted 1776
13 SASI_Hs01_00168030 predicted 1651
14 SASI_Hs01_00168031 predicted 1746
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080806 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00069019 predicted 1738
2 SASI_Hs01_00069020 predicted 2749
3 SASI_Hs01_00069021 predicted 1739
4 SASI_Hs01_00069022 predicted 2755
5 SASI_Hs01_00069023 predicted 1742
6 SASI_Hs01_00069024 predicted 2784
7 SASI_Hs01_00069025 predicted 2777
8 SASI_Hs01_00069026 predicted 1414
9 SASI_Hs02_00362575 predicted 1709
10 SASI_Hs01_00069027 predicted 1755
11 SASI_Hs01_00069028 predicted 1812
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080807 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00232307 predicted 1796
2 SASI_Hs01_00232308 predicted 2782
3 SASI_Hs01_00232309 predicted 1810
4 SASI_Hs01_00232310 predicted 2785
5 SASI_Hs01_00232311 predicted 1811
6 SASI_Hs01_00232312 predicted 2810
7 SASI_Hs01_00232313 predicted 2811
8 SASI_Hs01_00232314 predicted 1484
9 SASI_Hs02_00362576 predicted 1779
10 SASI_Hs01_00232315 predicted 1827
11 SASI_Hs01_00232316 predicted 1874
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080808 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00238545 predicted 1860
2 SASI_Hs01_00238546 predicted 2798
3 SASI_Hs01_00238547 predicted 1865
4 SASI_Hs01_00238548 predicted 2798
5 SASI_Hs01_00238549 predicted 1865
6 SASI_Hs01_00238550 predicted 2828
7 SASI_Hs01_00238551 predicted 2824
8 SASI_Hs01_00238552 predicted 1533
9 SASI_Hs02_00362577 predicted 1840
10 SASI_Hs01_00238553 predicted 1883
11 SASI_Hs01_00238554 predicted 1938
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080809 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00031638 predicted 1857
2 SASI_Hs01_00031639 predicted 2792
3 SASI_Hs01_00031640 predicted 1862
4 SASI_Hs01_00031641 predicted 2792
5 SASI_Hs01_00031642 predicted 1860
6 SASI_Hs01_00031643 predicted 2830
7 SASI_Hs01_00031644 predicted 2827
8 SASI_Hs01_00031645 predicted 1542
9 SASI_Hs02_00362578 predicted 1831
10 SASI_Hs01_00031646 predicted 1884
11 SASI_Hs01_00031647 predicted 1937
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080810 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00099301 predicted 1697
2 SASI_Hs01_00099302 predicted 2716
3 SASI_Hs01_00099303 predicted 1708
4 SASI_Hs01_00099304 predicted 2722
5 SASI_Hs01_00099305 predicted 1701
6 SASI_Hs01_00099306 predicted 2743
7 SASI_Hs01_00099307 predicted 2750
8 SASI_Hs01_00099308 predicted 1374
9 SASI_Hs02_00362579 predicted 1678
10 SASI_Hs01_00099309 predicted 1721
11 SASI_Hs01_00099310 predicted 1773
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080811 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00031688 predicted 1788
2 SASI_Hs01_00031689 predicted 2726
3 SASI_Hs01_00031690 predicted 1798
4 SASI_Hs01_00031691 predicted 2733
5 SASI_Hs01_00031692 predicted 1795
6 SASI_Hs01_00031693 predicted 2757
7 SASI_Hs01_00031694 predicted 2761
8 SASI_Hs01_00031695 predicted 1475
9 SASI_Hs02_00362580 predicted 1770
10 SASI_Hs01_00031696 predicted 1819
11 SASI_Hs01_00031697 predicted 1870
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080812 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00017934 predicted 1685
2 SASI_Hs01_00017935 predicted 2704
3 SASI_Hs01_00017936 predicted 1695
4 SASI_Hs01_00017937 predicted 2703
5 SASI_Hs01_00017938 predicted 1694
6 SASI_Hs01_00017939 predicted 2731
7 SASI_Hs01_00017940 predicted 2735
8 SASI_Hs01_00017941 predicted 1363
9 SASI_Hs02_00362581 predicted 1666
10 SASI_Hs01_00017942 predicted 1712
11 SASI_Hs01_00017943 predicted 1761
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080813 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00155769 predicted 1678
2 SASI_Hs01_00155770 predicted 2691
3 SASI_Hs01_00155771 predicted 1680
4 SASI_Hs01_00155772 predicted 2695
5 SASI_Hs01_00155773 predicted 1679
6 SASI_Hs01_00155774 predicted 2730
7 SASI_Hs01_00155775 predicted 2727
8 SASI_Hs01_00155776 predicted 1360
9 SASI_Hs02_00362582 predicted 1657
10 SASI_Hs01_00155777 predicted 1700
11 SASI_Hs01_00155778 predicted 1757
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080814 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00214088 predicted 1675
2 SASI_Hs01_00214089 predicted 2692
3 SASI_Hs01_00214090 predicted 1680
4 SASI_Hs01_00214091 predicted 2686
5 SASI_Hs01_00214092 predicted 1681
6 SASI_Hs01_00214093 predicted 2719
7 SASI_Hs01_00214094 predicted 2714
8 SASI_Hs01_00214095 predicted 1348
9 SASI_Hs02_00362583 predicted 1645
10 SASI_Hs01_00214096 predicted 1690
11 SASI_Hs01_00214097 predicted 1744
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080815 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00061751 predicted 1700
2 SASI_Hs01_00061752 predicted 2559
3 SASI_Hs01_00061753 predicted 1707
4 SASI_Hs01_00061754 predicted 2556
5 SASI_Hs01_00061755 predicted 1712
6 SASI_Hs01_00061756 predicted 2585
7 SASI_Hs01_00061757 predicted 2581
8 SASI_Hs01_00061758 predicted 1385
9 SASI_Hs02_00362584 predicted 1681
10 SASI_Hs01_00061759 predicted 1728
11 SASI_Hs01_00061760 predicted 1781
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109172 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00245830 predicted 2055
2 SASI_Rn02_00245831 predicted 2642
3 SASI_Rn02_00245832 predicted 1675
4 SASI_Rn02_00245833 predicted 1597
5 SASI_Rn02_00245834 predicted 1352
6 SASI_Rn02_00245835 predicted 2336
7 SASI_Rn02_00245836 predicted 735
8 SASI_Rn02_00245837 predicted 1780
9 SASI_Rn02_00245838 predicted 1423
10 SASI_Rn02_00245839 predicted 743
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007731 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00061068 predicted 1800
2 SASI_Mm01_00061070 predicted 1203
3 SASI_Mm01_00061071 predicted 1362
4 SASI_Mm01_00061072 predicted 735
5 SASI_Mm02_00312323 predicted 1783
6 SASI_Mm01_00061073 predicted 1490
7 SASI_Mm01_00061074 predicted 1132
8 SASI_Mm01_00061075 predicted 1198
9 SASI_Mm01_00061076 predicted 1143
10 SASI_Mm01_00061077 predicted 1810
11 SASI_Mm01_00061069 predicted 1608
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007731
COL13A1 MISSION shRNA Bacterial Glycerol Stock
collagen, type XIII, alpha 1
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000442923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007731.2-756s21c1
Sequence:CCGGACGAGAAATGGAAGTTCTACTCTCGAGAGTAGAACTTCCATTTCTCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091748    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007731.1-2709s1c1
Sequence:CCGGCTGGCCTGTGTGTGTTTGTATCTCGAGATACAAACACACACAGGCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007731.1-2213s1c1
Sequence:CCGGCCGGGATTCACAGGAGAGAAACTCGAGTTTCTCTCCTGTGAATCCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007731.1-896s1c1
Sequence:CCGGCGTGTGGGTATCAAAGGTCAACTCGAGTTGACCTTTGATACCCACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007731.1-1185s1c1
Sequence:CCGGCCAACCCGATAATGTCCCTAACTCGAGTTAGGGACATTATCGGGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007731.1-1186s1c1
Sequence:CCGGCAACCCGATAATGTCCCTAAACTCGAGTTTAGGGACATTATCGGGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007731
COL13A1 MISSION shRNA shRNA Plasmid DNA
collagen, type XIII, alpha 1
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000442923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007731.2-756s21c1
Sequence:CCGGACGAGAAATGGAAGTTCTACTCTCGAGAGTAGAACTTCCATTTCTCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091748    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007731.1-2709s1c1
Sequence:CCGGCTGGCCTGTGTGTGTTTGTATCTCGAGATACAAACACACACAGGCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007731.1-2213s1c1
Sequence:CCGGCCGGGATTCACAGGAGAGAAACTCGAGTTTCTCTCCTGTGAATCCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007731.1-896s1c1
Sequence:CCGGCGTGTGGGTATCAAAGGTCAACTCGAGTTGACCTTTGATACCCACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007731.1-1185s1c1
Sequence:CCGGCCAACCCGATAATGTCCCTAACTCGAGTTAGGGACATTATCGGGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007731.1-1186s1c1
Sequence:CCGGCAACCCGATAATGTCCCTAAACTCGAGTTTAGGGACATTATCGGGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007731
COL13A1 MISSION shRNA Lentiviral Transduction Particles
collagen, type XIII, alpha 1
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000442923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007731.2-756s21c1
Sequence:CCGGACGAGAAATGGAAGTTCTACTCTCGAGAGTAGAACTTCCATTTCTCGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091748    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007731.1-2709s1c1
Sequence:CCGGCTGGCCTGTGTGTGTTTGTATCTCGAGATACAAACACACACAGGCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007731.1-2213s1c1
Sequence:CCGGCCGGGATTCACAGGAGAGAAACTCGAGTTTCTCTCCTGTGAATCCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007731.1-896s1c1
Sequence:CCGGCGTGTGGGTATCAAAGGTCAACTCGAGTTGACCTTTGATACCCACACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007731.1-1185s1c1
Sequence:CCGGCCAACCCGATAATGTCCCTAACTCGAGTTAGGGACATTATCGGGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007731.1-1186s1c1
Sequence:CCGGCAACCCGATAATGTCCCTAAACTCGAGTTTAGGGACATTATCGGGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080812
COL13A1 MISSION shRNA Bacterial Glycerol Stock
collagen, type XIII, alpha 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000116262    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080812.2-2751s1c1
Sequence:CCGGGCATGATATTTGTGCACATTTCTCGAGAAATGTGCACAAATATCATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080812.2-780s1c1
Sequence:CCGGCAGCAAATGGAGACGGCTATTCTCGAGAATAGCCGTCTCCATTTGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080812.2-921s1c1
Sequence:CCGGACTAGAGGTTTCCCTGGATTTCTCGAGAAATCCAGGGAAACCTCTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080812.2-1691s1c1
Sequence:CCGGGATGGTGGATTACAATGGAAACTCGAGTTTCCATTGTAATCCACCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080812.2-2481s1c1
Sequence:CCGGGAAGATGGCTTACCAGTCCAACTCGAGTTGGACTGGTAAGCCATCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080812
COL13A1 MISSION shRNA shRNA Plasmid DNA
collagen, type XIII, alpha 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000116262    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080812.2-2751s1c1
Sequence:CCGGGCATGATATTTGTGCACATTTCTCGAGAAATGTGCACAAATATCATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080812.2-780s1c1
Sequence:CCGGCAGCAAATGGAGACGGCTATTCTCGAGAATAGCCGTCTCCATTTGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080812.2-921s1c1
Sequence:CCGGACTAGAGGTTTCCCTGGATTTCTCGAGAAATCCAGGGAAACCTCTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080812.2-1691s1c1
Sequence:CCGGGATGGTGGATTACAATGGAAACTCGAGTTTCCATTGTAATCCACCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080812.2-2481s1c1
Sequence:CCGGGAAGATGGCTTACCAGTCCAACTCGAGTTGGACTGGTAAGCCATCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080812
COL13A1 MISSION shRNA Lentiviral Transduction Particles
collagen, type XIII, alpha 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000116262    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080812.2-2751s1c1
Sequence:CCGGGCATGATATTTGTGCACATTTCTCGAGAAATGTGCACAAATATCATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080812.2-780s1c1
Sequence:CCGGCAGCAAATGGAGACGGCTATTCTCGAGAATAGCCGTCTCCATTTGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080812.2-921s1c1
Sequence:CCGGACTAGAGGTTTCCCTGGATTTCTCGAGAAATCCAGGGAAACCTCTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080812.2-1691s1c1
Sequence:CCGGGATGGTGGATTACAATGGAAACTCGAGTTTCCATTGTAATCCACCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080812.2-2481s1c1
Sequence:CCGGGAAGATGGCTTACCAGTCCAACTCGAGTTGGACTGGTAAGCCATCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)