EMAIL THIS PAGE TO A FRIEND

COL14A1

collagen, type XIV, alpha 1

74 Gene Product Result for
Synonyms: UND
Gene ID:
Human(7373) Summary: This gene encodes the alpha chain of type XIV collagen, a member of the FACIT (fibril-associated collagens with interrupted triple helices) collagen family. Type XIV collagen interacts with the fibril surface and is involved in the regulation of fibrillogenesis. [provided by RefSeq, Jan 2013]
Mouse(12818) collagen, type XIV, alpha 1
Rat(314981) collagen, type XIV, alpha 1
sheep(101120758) collagen, type XIV, alpha 1
Domestic Rabbit(100353761) collagen, type XIV, alpha 1
naked mole-rat(101714283) collagen, type XIV, alpha 1
domestic guinea pig(100726718) collagen, type XIV, alpha 1
chicken(396276) collagen, type XIV, alpha 1
dog(475085) collagen, type XIV, alpha 1
Horse(100033841) collagen, type XIV, alpha 1
cow(781493) collagen, type XIV, alpha 1
domestic cat(101098925) collagen, type XIV, alpha 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181277 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_181277 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_181277 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_021110 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021110 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021110 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021110 Rosetta Predictions human pricing
NM_001130548 Rosetta Predictions rat pricing
NM_181277 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021110 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00237356 predicted 2784
2 SASI_Hs01_00237359 predicted 1939
3 SASI_Hs02_00354604 predicted 3606
4 SASI_Hs01_00237360 predicted 3253
5 SASI_Hs01_00237361 predicted 842
6 SASI_Hs01_00237362 predicted 2690
7 SASI_Hs01_00237363 predicted 925
8 SASI_Hs01_00237364 predicted 5110
9 SASI_Hs02_00354605 predicted 2935
10 SASI_Hs02_00354606 predicted 2592
11 SASI_Hs01_00237357 predicted 3542
12 SASI_Hs01_00237358 predicted 1633
13 SASI_Hs01_00237365 predicted 2330
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130548 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00255659 predicted 2486
2 SASI_Rn02_00255660 predicted 377
3 SASI_Rn02_00255661 predicted 3705
4 SASI_Rn02_00255662 predicted 866
5 SASI_Rn02_00255663 predicted 920
6 SASI_Rn02_00255664 predicted 1918
7 SASI_Rn02_00255665 predicted 1636
8 SASI_Rn02_00255666 predicted 4372
9 SASI_Rn02_00255667 predicted 3937
10 SASI_Rn02_00255668 predicted 2517
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181277 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00191162 predicted 2486
2 SASI_Mm02_00349647 predicted 855
3 SASI_Mm01_00191163 predicted 765
4 SASI_Mm01_00191164 predicted 3607
5 SASI_Mm01_00191166 predicted 2509
6 SASI_Mm01_00191167 predicted 928
7 SASI_Mm01_00191168 predicted 3537
8 SASI_Mm01_00191169 predicted 1629
9 SASI_Mm01_00191170 predicted 1909
10 SASI_Mm02_00349648 predicted 1762
11 SASI_Mm01_00191165 predicted 4121
12 SASI_Mm01_00191171 predicted 4424
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181277
COL14A1 MISSION shRNA Bacterial Glycerol Stock
collagen, type XIV, alpha 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000089888    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181277.1-5980s1c1
Sequence:CCGGCGTGGTTATATCAGAGGGAATCTCGAGATTCCCTCTGATATAACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181277.1-2150s1c1
Sequence:CCGGCGCCCAGCAATACTTGGAAATCTCGAGATTTCCAAGTATTGCTGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181277.1-3957s1c1
Sequence:CCGGGCAGGGTTTAAGATGATGGAACTCGAGTTCCATCATCTTAAACCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181277.1-574s1c1
Sequence:CCGGCCTACTATAAAGACAAGGAAACTCGAGTTTCCTTGTCTTTATAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181277.1-4832s1c1
Sequence:CCGGGCCGGGTGATAAAGGAGATAACTCGAGTTATCTCCTTTATCACCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000444192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181277.3-4207s21c1
Sequence:CCGGAGCCGCTAGTTGGGATCATATCTCGAGATATGATCCCAACTAGCGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181277.3-795s21c1
Sequence:CCGGTTCAGGCTTGTGCGCAATTTCCTCGAGGAAATTGCGCACAAGCCTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437306    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181277.3-6061s21c1
Sequence:CCGGCAGTGACCTTGCTGGTAATTGCTCGAGCAATTACCAGCAAGGTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181277
COL14A1 MISSION shRNA shRNA Plasmid DNA
collagen, type XIV, alpha 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000089888    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181277.1-5980s1c1
Sequence:CCGGCGTGGTTATATCAGAGGGAATCTCGAGATTCCCTCTGATATAACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181277.1-2150s1c1
Sequence:CCGGCGCCCAGCAATACTTGGAAATCTCGAGATTTCCAAGTATTGCTGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181277.1-3957s1c1
Sequence:CCGGGCAGGGTTTAAGATGATGGAACTCGAGTTCCATCATCTTAAACCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181277.1-574s1c1
Sequence:CCGGCCTACTATAAAGACAAGGAAACTCGAGTTTCCTTGTCTTTATAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181277.1-4832s1c1
Sequence:CCGGGCCGGGTGATAAAGGAGATAACTCGAGTTATCTCCTTTATCACCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000444192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181277.3-4207s21c1
Sequence:CCGGAGCCGCTAGTTGGGATCATATCTCGAGATATGATCCCAACTAGCGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181277.3-795s21c1
Sequence:CCGGTTCAGGCTTGTGCGCAATTTCCTCGAGGAAATTGCGCACAAGCCTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437306    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181277.3-6061s21c1
Sequence:CCGGCAGTGACCTTGCTGGTAATTGCTCGAGCAATTACCAGCAAGGTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181277
COL14A1 MISSION shRNA Lentiviral Transduction Particles
collagen, type XIV, alpha 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000089888    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181277.1-5980s1c1
Sequence:CCGGCGTGGTTATATCAGAGGGAATCTCGAGATTCCCTCTGATATAACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181277.1-2150s1c1
Sequence:CCGGCGCCCAGCAATACTTGGAAATCTCGAGATTTCCAAGTATTGCTGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181277.1-3957s1c1
Sequence:CCGGGCAGGGTTTAAGATGATGGAACTCGAGTTCCATCATCTTAAACCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181277.1-574s1c1
Sequence:CCGGCCTACTATAAAGACAAGGAAACTCGAGTTTCCTTGTCTTTATAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181277.1-4832s1c1
Sequence:CCGGGCCGGGTGATAAAGGAGATAACTCGAGTTATCTCCTTTATCACCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000444192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181277.3-4207s21c1
Sequence:CCGGAGCCGCTAGTTGGGATCATATCTCGAGATATGATCCCAACTAGCGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181277.3-795s21c1
Sequence:CCGGTTCAGGCTTGTGCGCAATTTCCTCGAGGAAATTGCGCACAAGCCTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437306    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181277.3-6061s21c1
Sequence:CCGGCAGTGACCTTGCTGGTAATTGCTCGAGCAATTACCAGCAAGGTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021110
COL14A1 MISSION shRNA Bacterial Glycerol Stock
collagen, type XIV, alpha 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000116557    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021110.1-6221s1c1
Sequence:CCGGGCTTTCTGAATTTGGTAGTTTCTCGAGAAACTACCAAATTCAGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021110.1-946s1c1
Sequence:CCGGCCTCCCATATAAAGGAGGAAACTCGAGTTTCCTCCTTTATATGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021110.1-4499s1c1
Sequence:CCGGCCGTTCCAGTTACAGATGTTTCTCGAGAAACATCTGTAACTGGAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021110.1-3936s1c1
Sequence:CCGGGCATTGATCTTGCAGGATTTACTCGAGTAAATCCTGCAAGATCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021110.1-541s1c1
Sequence:CCGGCCAGAATTACACAGTTCAAATCTCGAGATTTGAACTGTGTAATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021110.1-4412s21c1
Sequence:CCGGATGAACGCATCAGCTAATATCCTCGAGGATATTAGCTGATGCGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021110.1-2002s21c1
Sequence:CCGGGGTTGAAGTCGATCCTATTACCTCGAGGTAATAGGATCGACTTCAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021110.1-1905s21c1
Sequence:CCGGGCTCTAACAGTGCTCGATTAACTCGAGTTAATCGAGCACTGTTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021110
COL14A1 MISSION shRNA shRNA Plasmid DNA
collagen, type XIV, alpha 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000116557    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021110.1-6221s1c1
Sequence:CCGGGCTTTCTGAATTTGGTAGTTTCTCGAGAAACTACCAAATTCAGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021110.1-946s1c1
Sequence:CCGGCCTCCCATATAAAGGAGGAAACTCGAGTTTCCTCCTTTATATGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021110.1-4499s1c1
Sequence:CCGGCCGTTCCAGTTACAGATGTTTCTCGAGAAACATCTGTAACTGGAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021110.1-3936s1c1
Sequence:CCGGGCATTGATCTTGCAGGATTTACTCGAGTAAATCCTGCAAGATCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021110.1-541s1c1
Sequence:CCGGCCAGAATTACACAGTTCAAATCTCGAGATTTGAACTGTGTAATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021110.1-4412s21c1
Sequence:CCGGATGAACGCATCAGCTAATATCCTCGAGGATATTAGCTGATGCGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021110.1-2002s21c1
Sequence:CCGGGGTTGAAGTCGATCCTATTACCTCGAGGTAATAGGATCGACTTCAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021110.1-1905s21c1
Sequence:CCGGGCTCTAACAGTGCTCGATTAACTCGAGTTAATCGAGCACTGTTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021110
COL14A1 MISSION shRNA Lentiviral Transduction Particles
collagen, type XIV, alpha 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000116557    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021110.1-6221s1c1
Sequence:CCGGGCTTTCTGAATTTGGTAGTTTCTCGAGAAACTACCAAATTCAGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021110.1-946s1c1
Sequence:CCGGCCTCCCATATAAAGGAGGAAACTCGAGTTTCCTCCTTTATATGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021110.1-4499s1c1
Sequence:CCGGCCGTTCCAGTTACAGATGTTTCTCGAGAAACATCTGTAACTGGAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021110.1-3936s1c1
Sequence:CCGGGCATTGATCTTGCAGGATTTACTCGAGTAAATCCTGCAAGATCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021110.1-541s1c1
Sequence:CCGGCCAGAATTACACAGTTCAAATCTCGAGATTTGAACTGTGTAATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021110.1-4412s21c1
Sequence:CCGGATGAACGCATCAGCTAATATCCTCGAGGATATTAGCTGATGCGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021110.1-2002s21c1
Sequence:CCGGGGTTGAAGTCGATCCTATTACCTCGAGGTAATAGGATCGACTTCAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021110.1-1905s21c1
Sequence:CCGGGCTCTAACAGTGCTCGATTAACTCGAGTTAATCGAGCACTGTTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks