EMAIL THIS PAGE TO A FRIEND

COL15A1

collagen, type XV, alpha 1

110 Gene Product Result for
UniProtKB ID: P39059, Q5T6J4, Q9UDC5, Q9Y4W4
Gene ID:
Human(1306) Summary: This gene encodes the alpha chain of type XV collagen, a member of the FACIT collagen family (fibril-associated collagens with interrupted helices). Type XV collagen has a wide tissue distribution but the strongest expression is localized to basement membrane zones so it may function to adhere basement membranes to underlying connective tissue stroma. The proteolytically produced C-terminal fragment of type XV collagen is restin, a potentially antiangiogenic protein that is closely related to endostatin. Mouse studies have shown that collagen XV deficiency is associated with muscle and microvessel deterioration. [provided by RefSeq, May 2013]
Mouse(12819) collagen, type XV, alpha 1
Rat(298069) collagen, type XV, alpha 1
chicken(420803) collagen, type XV, alpha 1
cow(100139730) collagen, type XV, alpha 1
Horse(100063829) collagen, type XV, alpha 1
domestic cat(101093810) collagen, type XV, alpha 1
dog(474778) collagen, type XV, alpha 1
domestic guinea pig(100714952) collagen, type XV, alpha 1
naked mole-rat(101708400) collagen, type XV, alpha 1
sheep(101102453) collagen, type XV, alpha 1
Domestic Rabbit(100346072) collagen, type XV, alpha 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001855 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001855 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001855 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009928 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009928 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009928 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001855 Rosetta Predictions human pricing
XM_001066530 Rosetta Predictions rat pricing
XM_216399 Rosetta Predictions rat pricing
NM_009928 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001855 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00092178 predicted 696
2 SASI_Hs01_00092180 predicted 3599
3 SASI_Hs01_00092181 predicted 4005
4 SASI_Hs01_00092182 predicted 2257
5 SASI_Hs02_00332675 predicted 2890
6 SASI_Hs01_00092183 predicted 992
7 SASI_Hs02_00332676 predicted 2604
8 SASI_Hs02_00332677 predicted 798
9 SASI_Hs01_00092184 predicted 2533
10 SASI_Hs02_00332678 predicted 719
11 SASI_Hs01_00092177 predicted 3787
12 SASI_Hs01_00092179 predicted 2567
13 SASI_Hs01_00092185 predicted 1531
14 SASI_Hs01_00092186 predicted 1075
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001066530 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00317823 predicted 3560
2 SASI_Rn02_00317824 predicted 897
3 SASI_Rn02_00317825 predicted 2351
4 SASI_Rn02_00317826 predicted 3938
5 SASI_Rn02_00317827 predicted 4029
6 SASI_Rn02_00317828 predicted 1725
7 SASI_Rn02_00317829 predicted 3543
8 SASI_Rn02_00317830 predicted 706
9 SASI_Rn02_00317831 predicted 1983
10 SASI_Rn02_00317832 predicted 820
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_216399 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00376580 predicted 3568
2 SASI_Rn02_00376581 predicted 894
3 SASI_Rn02_00376582 predicted 2352
4 SASI_Rn02_00376583 predicted 3938
5 SASI_Rn02_00376584 predicted 4031
6 SASI_Rn02_00376585 predicted 1729
7 SASI_Rn02_00376586 predicted 3544
8 SASI_Rn02_00376587 predicted 703
9 SASI_Rn02_00376588 predicted 1978
10 SASI_Rn02_00376589 predicted 819
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009928 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00090599 predicted 4447
2 SASI_Mm01_00090600 predicted 3730
3 SASI_Mm01_00090601 predicted 4084
4 SASI_Mm01_00090602 predicted 1244
5 SASI_Mm02_00317469 predicted 4430
6 SASI_Mm02_00317470 predicted 4185
7 SASI_Mm02_00317471 predicted 1496
8 SASI_Mm01_00090605 predicted 2352
9 SASI_Mm01_00090606 predicted 979
10 SASI_Mm01_00090607 predicted 2133
11 SASI_Mm01_00090603 predicted 3536
12 SASI_Mm01_00090604 predicted 1935
13 SASI_Mm01_00090608 predicted 2549
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001855
COL15A1 MISSION shRNA Bacterial Glycerol Stock
collagen, type XV, alpha 1
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000376591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001855.3-2608s21c1
Sequence:CCGGTGTCTAATTCCTTGATCAATACTCGAGTATTGATCAAGGAATTAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001855.3-4309s21c1
Sequence:CCGGGCTGTGCTAATCGGCTAATTGCTCGAGCAATTAGCCGATTAGCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001855.3-1410s21c1
Sequence:CCGGCCAGATAATGAAGAGCGTTTACTCGAGTAAACGCTCTTCATTATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370404    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001855.3-4813s21c1
Sequence:CCGGTTTCACGTACATCCATCATTTCTCGAGAAATGATGGATGTACGTGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365276    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001855.3-4620s21c1
Sequence:CCGGACGCATCCCAACATAGGTTAACTCGAGTTAACCTATGTTGGGATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001855.3-3812s21c1
Sequence:CCGGGCCTCCACCAAACCCTATTTCCTCGAGGAAATAGGGTTTGGTGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001855.3-4124s21c1
Sequence:CCGGCTTTGATGGTCGAGACATAATCTCGAGATTATGTCTCGACCATCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001855.3-964s21c1
Sequence:CCGGACGGAGTAGCTGAGATCTTAGCTCGAGCTAAGATCTCAGCTACTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001855.2-4082s1c1
Sequence:CCGGCCTTTGATGGTCGAGACATAACTCGAGTTATGTCTCGACCATCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148105    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001855.2-4636s1c1
Sequence:CCGGGCATCCTTCAGACAGTTATATCTCGAGATATAACTGTCTGAAGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001855.2-4094s1c1
Sequence:CCGGGAGACATAATGACAGATCCTTCTCGAGAAGGATCTGTCATTATGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147569    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001855.2-4818s1c1
Sequence:CCGGGACTGCTCAAATGATCCTATTCTCGAGAATAGGATCATTTGAGCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183330    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001855.2-4891s1c1
Sequence:CCGGGCCATCATGCTTTAGGAATTTCTCGAGAAATTCCTAAAGCATGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001855
COL15A1 MISSION shRNA shRNA Plasmid DNA
collagen, type XV, alpha 1
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000376591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001855.3-2608s21c1
Sequence:CCGGTGTCTAATTCCTTGATCAATACTCGAGTATTGATCAAGGAATTAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001855.3-4309s21c1
Sequence:CCGGGCTGTGCTAATCGGCTAATTGCTCGAGCAATTAGCCGATTAGCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001855.3-1410s21c1
Sequence:CCGGCCAGATAATGAAGAGCGTTTACTCGAGTAAACGCTCTTCATTATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370404    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001855.3-4813s21c1
Sequence:CCGGTTTCACGTACATCCATCATTTCTCGAGAAATGATGGATGTACGTGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365276    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001855.3-4620s21c1
Sequence:CCGGACGCATCCCAACATAGGTTAACTCGAGTTAACCTATGTTGGGATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001855.3-3812s21c1
Sequence:CCGGGCCTCCACCAAACCCTATTTCCTCGAGGAAATAGGGTTTGGTGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001855.3-4124s21c1
Sequence:CCGGCTTTGATGGTCGAGACATAATCTCGAGATTATGTCTCGACCATCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001855.3-964s21c1
Sequence:CCGGACGGAGTAGCTGAGATCTTAGCTCGAGCTAAGATCTCAGCTACTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001855.2-4082s1c1
Sequence:CCGGCCTTTGATGGTCGAGACATAACTCGAGTTATGTCTCGACCATCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148105    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001855.2-4636s1c1
Sequence:CCGGGCATCCTTCAGACAGTTATATCTCGAGATATAACTGTCTGAAGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001855.2-4094s1c1
Sequence:CCGGGAGACATAATGACAGATCCTTCTCGAGAAGGATCTGTCATTATGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147569    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001855.2-4818s1c1
Sequence:CCGGGACTGCTCAAATGATCCTATTCTCGAGAATAGGATCATTTGAGCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183330    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001855.2-4891s1c1
Sequence:CCGGGCCATCATGCTTTAGGAATTTCTCGAGAAATTCCTAAAGCATGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001855
COL15A1 MISSION shRNA Lentiviral Transduction Particles
collagen, type XV, alpha 1
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000376591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001855.3-2608s21c1
Sequence:CCGGTGTCTAATTCCTTGATCAATACTCGAGTATTGATCAAGGAATTAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001855.3-4309s21c1
Sequence:CCGGGCTGTGCTAATCGGCTAATTGCTCGAGCAATTAGCCGATTAGCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001855.3-1410s21c1
Sequence:CCGGCCAGATAATGAAGAGCGTTTACTCGAGTAAACGCTCTTCATTATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370404    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001855.3-4813s21c1
Sequence:CCGGTTTCACGTACATCCATCATTTCTCGAGAAATGATGGATGTACGTGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365276    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001855.3-4620s21c1
Sequence:CCGGACGCATCCCAACATAGGTTAACTCGAGTTAACCTATGTTGGGATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001855.3-3812s21c1
Sequence:CCGGGCCTCCACCAAACCCTATTTCCTCGAGGAAATAGGGTTTGGTGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001855.3-4124s21c1
Sequence:CCGGCTTTGATGGTCGAGACATAATCTCGAGATTATGTCTCGACCATCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001855.3-964s21c1
Sequence:CCGGACGGAGTAGCTGAGATCTTAGCTCGAGCTAAGATCTCAGCTACTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001855.2-4082s1c1
Sequence:CCGGCCTTTGATGGTCGAGACATAACTCGAGTTATGTCTCGACCATCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148105    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001855.2-4636s1c1
Sequence:CCGGGCATCCTTCAGACAGTTATATCTCGAGATATAACTGTCTGAAGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001855.2-4094s1c1
Sequence:CCGGGAGACATAATGACAGATCCTTCTCGAGAAGGATCTGTCATTATGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147569    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001855.2-4818s1c1
Sequence:CCGGGACTGCTCAAATGATCCTATTCTCGAGAATAGGATCATTTGAGCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183330    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001855.2-4891s1c1
Sequence:CCGGGCCATCATGCTTTAGGAATTTCTCGAGAAATTCCTAAAGCATGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009928
COL15A1 MISSION shRNA Bacterial Glycerol Stock
collagen, type XV, alpha 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000109528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009928.2-961s1c1
Sequence:CCGGCCTAAAGAATCACACGTTGATCTCGAGATCAACGTGTGATTCTTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009928.2-477s1c1
Sequence:CCGGCTTCGCTATTACCGATGCTTTCTCGAGAAAGCATCGGTAATAGCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009928.2-958s1c1
Sequence:CCGGCCGCCTAAAGAATCACACGTTCTCGAGAACGTGTGATTCTTTAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009928.2-3227s1c1
Sequence:CCGGCCAGCAACAACCTCTTTGTATCTCGAGATACAAAGAGGTTGTTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109525    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009928.2-4976s1c1
Sequence:CCGGCCCGGTCTTATGATTTCCATTCTCGAGAATGGAAATCATAAGACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009928
COL15A1 MISSION shRNA shRNA Plasmid DNA
collagen, type XV, alpha 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000109528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009928.2-961s1c1
Sequence:CCGGCCTAAAGAATCACACGTTGATCTCGAGATCAACGTGTGATTCTTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009928.2-477s1c1
Sequence:CCGGCTTCGCTATTACCGATGCTTTCTCGAGAAAGCATCGGTAATAGCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009928.2-958s1c1
Sequence:CCGGCCGCCTAAAGAATCACACGTTCTCGAGAACGTGTGATTCTTTAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009928.2-3227s1c1
Sequence:CCGGCCAGCAACAACCTCTTTGTATCTCGAGATACAAAGAGGTTGTTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109525    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009928.2-4976s1c1
Sequence:CCGGCCCGGTCTTATGATTTCCATTCTCGAGAATGGAAATCATAAGACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009928
COL15A1 MISSION shRNA Lentiviral Transduction Particles
collagen, type XV, alpha 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000109528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009928.2-961s1c1
Sequence:CCGGCCTAAAGAATCACACGTTGATCTCGAGATCAACGTGTGATTCTTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009928.2-477s1c1
Sequence:CCGGCTTCGCTATTACCGATGCTTTCTCGAGAAAGCATCGGTAATAGCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009928.2-958s1c1
Sequence:CCGGCCGCCTAAAGAATCACACGTTCTCGAGAACGTGTGATTCTTTAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009928.2-3227s1c1
Sequence:CCGGCCAGCAACAACCTCTTTGTATCTCGAGATACAAAGAGGTTGTTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109525    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009928.2-4976s1c1
Sequence:CCGGCCCGGTCTTATGATTTCCATTCTCGAGAATGGAAATCATAAGACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks