EMAIL THIS PAGE TO A FRIEND

COL16A1

collagen, type XVI, alpha 1

70 Gene Product Result for
Synonyms: 447AA
UniProtKB ID: Q07092, Q16593, Q59F89, Q71RG9
Gene ID:
Human(1307) Summary: This gene encodes the alpha chain of type XVI collagen, a member of the FACIT collagen family (fibril-associated collagens with interrupted helices). Members of this collagen family are found in association with fibril-forming collagens such as type I and II, and serve to maintain the integrity of the extracellular matrix. High levels of type XVI collagen have been found in fibroblasts and keratinocytes, and in smooth muscle and amnion. [provided by RefSeq, Jul 2008]
Mouse(107581) collagen, type XVI, alpha 1
Rat(366474) collagen, type XVI, alpha 1
chicken(430477) collagen, type XVI, alpha 1
domestic cat(101095996) collagen, type XVI, alpha 1
cow(507010) collagen, type XVI, alpha 1
Horse(100056083) collagen, type XVI, alpha 1
dog(487318) collagen, type XVI, alpha 1
sheep(101107002) collagen, type XVI, alpha 1
naked mole-rat(101705401) collagen, type XVI, alpha 1
domestic guinea pig(100728988) collagen, type XVI, alpha 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028266 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028266 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028266 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001856 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001856 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001856 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001856 Rosetta Predictions human pricing
NM_001015033 Rosetta Predictions rat pricing
NM_028266 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001856 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00046749 predicted 464
2 SASI_Hs01_00046750 predicted 4674
3 SASI_Hs01_00046751 predicted 1266
4 SASI_Hs01_00046752 predicted 750
5 SASI_Hs01_00046753 predicted 698
6 SASI_Hs02_00332679 predicted 650
7 SASI_Hs01_00046754 predicted 1429
8 SASI_Hs01_00046755 predicted 538
9 SASI_Hs01_00046756 predicted 3187
10 SASI_Hs01_00046757 predicted 4924
11 SASI_Hs01_00046748 predicted 4726
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001015033 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00202160 predicted 4537
2 SASI_Rn02_00202161 predicted 523
3 SASI_Rn02_00202162 predicted 4520
4 SASI_Rn02_00202163 predicted 4554
5 SASI_Rn02_00202164 predicted 532
6 SASI_Rn02_00202165 predicted 963
7 SASI_Rn02_00202166 predicted 316
8 SASI_Rn02_00202167 predicted 327
9 SASI_Rn02_00202168 predicted 1004
10 SASI_Rn02_00202169 predicted 791
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028266 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00033786 predicted 4460
2 SASI_Mm01_00033787 predicted 1298
3 SASI_Mm01_00033788 predicted 4443
4 SASI_Mm01_00033789 predicted 4481
5 SASI_Mm01_00033791 predicted 2807
6 SASI_Mm01_00033792 predicted 1526
7 SASI_Mm01_00033793 predicted 362
8 SASI_Mm01_00033794 predicted 3035
9 SASI_Mm02_00333632 predicted 4479
10 SASI_Mm02_00333633 predicted 610
11 SASI_Mm01_00033790 predicted 579
12 SASI_Mm01_00033795 predicted 357
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028266
VALIDATED
COL16A1 MISSION shRNA Bacterial Glycerol Stock
collagen, type XVI, alpha 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000090358    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028266.3-4996s1c1
Sequence:CCGGGAAGGACTCTACTAGGAATAACTCGAGTTATTCCTAGTAGAGTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028266.3-1104s1c1
Sequence:CCGGGCAGCTCATGGGAAGAAACATCTCGAGATGTTTCTTCCCATGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028266.3-4824s1c1
Sequence:CCGGCCAGCAAGGTATTCCTGGGATCTCGAGATCCCAGGAATACCTTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028266.3-4479s1c1
Sequence:CCGGGAGGTTTATCAGACAAGAGATCTCGAGATCTCTTGTCTGATAAACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028266.3-570s1c1
Sequence:CCGGCCGGAACACATGGTACTTGTTCTCGAGAACAAGTACCATGTGTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028266
VALIDATED
COL16A1 MISSION shRNA shRNA Plasmid DNA
collagen, type XVI, alpha 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000090358    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028266.3-4996s1c1
Sequence:CCGGGAAGGACTCTACTAGGAATAACTCGAGTTATTCCTAGTAGAGTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028266.3-1104s1c1
Sequence:CCGGGCAGCTCATGGGAAGAAACATCTCGAGATGTTTCTTCCCATGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028266.3-4824s1c1
Sequence:CCGGCCAGCAAGGTATTCCTGGGATCTCGAGATCCCAGGAATACCTTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028266.3-4479s1c1
Sequence:CCGGGAGGTTTATCAGACAAGAGATCTCGAGATCTCTTGTCTGATAAACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028266.3-570s1c1
Sequence:CCGGCCGGAACACATGGTACTTGTTCTCGAGAACAAGTACCATGTGTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028266
VALIDATED
COL16A1 MISSION shRNA Lentiviral Transduction Particles
collagen, type XVI, alpha 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000090358    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028266.3-4996s1c1
Sequence:CCGGGAAGGACTCTACTAGGAATAACTCGAGTTATTCCTAGTAGAGTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028266.3-1104s1c1
Sequence:CCGGGCAGCTCATGGGAAGAAACATCTCGAGATGTTTCTTCCCATGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028266.3-4824s1c1
Sequence:CCGGCCAGCAAGGTATTCCTGGGATCTCGAGATCCCAGGAATACCTTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028266.3-4479s1c1
Sequence:CCGGGAGGTTTATCAGACAAGAGATCTCGAGATCTCTTGTCTGATAAACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028266.3-570s1c1
Sequence:CCGGCCGGAACACATGGTACTTGTTCTCGAGAACAAGTACCATGTGTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001856
COL16A1 MISSION shRNA Bacterial Glycerol Stock
collagen, type XVI, alpha 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000108320    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001856.2-5090s1c1
Sequence:CCGGCGTTGGGAATAAATGGCCAAACTCGAGTTTGGCCATTTATTCCCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001856.2-699s1c1
Sequence:CCGGCGACTTTGTGTCCTGCATCTTCTCGAGAAGATGCAGGACACAAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001856.2-585s1c1
Sequence:CCGGCCAGAAGACGTGGTATCTGTTCTCGAGAACAGATACCACGTCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001856.2-619s1c1
Sequence:CCGGGCAAATGGGTATCCACAGATACTCGAGTATCTGTGGATACCCATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001856.3-4653s21c1
Sequence:CCGGATGGGAGACATGGTGAATTATCTCGAGATAATTCACCATGTCTCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001856.3-4691s21c1
Sequence:CCGGCATCAGACAAGAGATCATTAACTCGAGTTAATGATCTCTTGTCTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001856.3-1905s21c1
Sequence:CCGGCCTGAAGGGTTCCAGAACTTTCTCGAGAAAGTTCTGGAACCCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001856.3-1147s21c1
Sequence:CCGGATGAGCTCATTGAGATCAATCCTCGAGGATTGATCTCAATGAGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299992    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001856.3-5212s21c1
Sequence:CCGGCGTTGGGAATAAATGGCCAAACTCGAGTTTGGCCATTTATTCCCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001856
COL16A1 MISSION shRNA shRNA Plasmid DNA
collagen, type XVI, alpha 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000108320    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001856.2-5090s1c1
Sequence:CCGGCGTTGGGAATAAATGGCCAAACTCGAGTTTGGCCATTTATTCCCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001856.2-699s1c1
Sequence:CCGGCGACTTTGTGTCCTGCATCTTCTCGAGAAGATGCAGGACACAAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001856.2-585s1c1
Sequence:CCGGCCAGAAGACGTGGTATCTGTTCTCGAGAACAGATACCACGTCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001856.2-619s1c1
Sequence:CCGGGCAAATGGGTATCCACAGATACTCGAGTATCTGTGGATACCCATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001856.3-4653s21c1
Sequence:CCGGATGGGAGACATGGTGAATTATCTCGAGATAATTCACCATGTCTCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001856.3-4691s21c1
Sequence:CCGGCATCAGACAAGAGATCATTAACTCGAGTTAATGATCTCTTGTCTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001856.3-1905s21c1
Sequence:CCGGCCTGAAGGGTTCCAGAACTTTCTCGAGAAAGTTCTGGAACCCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001856.3-1147s21c1
Sequence:CCGGATGAGCTCATTGAGATCAATCCTCGAGGATTGATCTCAATGAGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299992    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001856.3-5212s21c1
Sequence:CCGGCGTTGGGAATAAATGGCCAAACTCGAGTTTGGCCATTTATTCCCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001856
COL16A1 MISSION shRNA Lentiviral Transduction Particles
collagen, type XVI, alpha 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000108320    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001856.2-5090s1c1
Sequence:CCGGCGTTGGGAATAAATGGCCAAACTCGAGTTTGGCCATTTATTCCCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001856.2-699s1c1
Sequence:CCGGCGACTTTGTGTCCTGCATCTTCTCGAGAAGATGCAGGACACAAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001856.2-585s1c1
Sequence:CCGGCCAGAAGACGTGGTATCTGTTCTCGAGAACAGATACCACGTCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001856.2-619s1c1
Sequence:CCGGGCAAATGGGTATCCACAGATACTCGAGTATCTGTGGATACCCATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001856.3-4653s21c1
Sequence:CCGGATGGGAGACATGGTGAATTATCTCGAGATAATTCACCATGTCTCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001856.3-4691s21c1
Sequence:CCGGCATCAGACAAGAGATCATTAACTCGAGTTAATGATCTCTTGTCTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001856.3-1905s21c1
Sequence:CCGGCCTGAAGGGTTCCAGAACTTTCTCGAGAAAGTTCTGGAACCCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001856.3-1147s21c1
Sequence:CCGGATGAGCTCATTGAGATCAATCCTCGAGGATTGATCTCAATGAGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299992    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001856.3-5212s21c1
Sequence:CCGGCGTTGGGAATAAATGGCCAAACTCGAGTTTGGCCATTTATTCCCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks