EMAIL THIS PAGE TO A FRIEND

COL17A1

collagen, type XVII, alpha 1

65 Gene Product Result for
Synonyms: BA16H23.2 BP180 BPA-2 BPAG2 LAD-1
UniProtKB ID: Q9UMD9, Q02802, Q5JV36, Q99018, Q9NQK9, Q9UC14
Gene ID:
Human(1308) Summary: This gene encodes the alpha chain of type XVII collagen. Unlike most collagens, collagen XVII is a transmembrane protein. Collagen XVII is a structural component of hemidesmosomes, multiprotein complexes at the dermal-epidermal basement membrane zone that mediate adhesion of keratinocytes to the underlying membrane. Mutations in this gene are associated with both generalized atrophic benign and junctional epidermolysis bullosa. Two homotrimeric forms of type XVII collagen exist. The full length form is the transmembrane protein. A soluble form, referred to as either ectodomain or LAD-1, is generated by proteolytic processing of the full length form. [provided by RefSeq, Jul 2008]
Mouse(12821) collagen, type XVII, alpha 1
Rat(294027) collagen, type XVII, alpha 1
domestic guinea pig(100721447) collagen, type XVII, alpha 1
naked mole-rat(101710063) collagen, type XVII, alpha 1
sheep(101116007) collagen, type XVII, alpha 1
chicken(396503) collagen, type XVII, alpha 1
dog(403739) collagen, type XVII, alpha 1
domestic cat(101096849) collagen, type XVII, alpha 1
cow(513804) collagen, type XVII, alpha 1
Horse(100069671) collagen, type XVII, alpha 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000494 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000494 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000494 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007732 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007732 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007732 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000494 Rosetta Predictions human pricing
NM_130778 Rosetta Predictions human pricing
NM_001106366 Rosetta Predictions rat pricing
NM_007732 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000494 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00123632 predicted 932
2 SASI_Hs01_00123633 predicted 3212
3 SASI_Hs01_00123634 predicted 4248
4 SASI_Hs02_00302654 predicted 2582
5 SASI_Hs01_00123635 predicted 274
6 SASI_Hs01_00123636 predicted 3196
7 SASI_Hs01_00123637 predicted 4261
8 SASI_Hs01_00123638 predicted 3220
9 SASI_Hs01_00123639 predicted 529
10 SASI_Hs01_00123640 predicted 4458
11 SASI_Hs01_00123631 predicted 1823
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130778 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00206514 predicted 1824
2 SASI_Hs01_00206515 predicted 936
3 SASI_Hs01_00206516 predicted 3217
4 SASI_Hs01_00206517 predicted 4253
5 SASI_Hs01_00206518 predicted 281
6 SASI_Hs01_00206519 predicted 3204
7 SASI_Hs01_00206520 predicted 4260
8 SASI_Hs01_00206521 predicted 3228
9 SASI_Hs01_00206522 predicted 535
10 SASI_Hs01_00206523 predicted 4456
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106366 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00218258 predicted 3338
2 SASI_Rn02_00218259 predicted 1976
3 SASI_Rn02_00218260 predicted 713
4 SASI_Rn02_00218261 predicted 2738
5 SASI_Rn02_00218262 predicted 447
6 SASI_Rn02_00218263 predicted 2742
7 SASI_Rn02_00218264 predicted 3296
8 SASI_Rn02_00218265 predicted 716
9 SASI_Rn02_00218266 predicted 1061
10 SASI_Rn02_00218267 predicted 774
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007732 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00193350 predicted 3974
2 SASI_Mm01_00193351 predicted 907
3 SASI_Mm01_00193352 predicted 3646
4 SASI_Mm01_00193353 predicted 708
5 SASI_Mm01_00193354 predicted 4612
6 SASI_Mm01_00193355 predicted 4566
7 SASI_Mm01_00193356 predicted 1969
8 SASI_Mm01_00193358 predicted 984
9 SASI_Mm01_00193359 predicted 1336
10 SASI_Mm02_00312324 predicted 692
11 SASI_Mm01_00193357 predicted 1355
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000494
COL17A1 MISSION shRNA Bacterial Glycerol Stock
collagen, type XVII, alpha 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000427473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000494.3-1263s21c1
Sequence:CCGGAGGACAGCGGGAAGGTCTTTACTCGAGTAAAGACCTTCCCGCTGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118937    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000494.2-5374s1c1
Sequence:CCGGGCAATGGACAAGGAAGGAATACTCGAGTATTCCTTCCTTGTCCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000494.2-1381s1c1
Sequence:CCGGCGAAGCTAATGGAGACCTGAACTCGAGTTCAGGTCTCCATTAGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000494.2-2992s1c1
Sequence:CCGGGTCCAGTTCTTTCGGACTCAACTCGAGTTGAGTCCGAAAGAACTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000494.2-2427s1c1
Sequence:CCGGCAAGAGGTGAACAAGGTCTTACTCGAGTAAGACCTTGTTCACCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000494.2-581s1c1
Sequence:CCGGCGAGAGAGTGAAATTCGAGTTCTCGAGAACTCGAATTTCACTCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000494
COL17A1 MISSION shRNA shRNA Plasmid DNA
collagen, type XVII, alpha 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000427473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000494.3-1263s21c1
Sequence:CCGGAGGACAGCGGGAAGGTCTTTACTCGAGTAAAGACCTTCCCGCTGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118937    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000494.2-5374s1c1
Sequence:CCGGGCAATGGACAAGGAAGGAATACTCGAGTATTCCTTCCTTGTCCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000494.2-1381s1c1
Sequence:CCGGCGAAGCTAATGGAGACCTGAACTCGAGTTCAGGTCTCCATTAGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000494.2-2992s1c1
Sequence:CCGGGTCCAGTTCTTTCGGACTCAACTCGAGTTGAGTCCGAAAGAACTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000494.2-2427s1c1
Sequence:CCGGCAAGAGGTGAACAAGGTCTTACTCGAGTAAGACCTTGTTCACCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000494.2-581s1c1
Sequence:CCGGCGAGAGAGTGAAATTCGAGTTCTCGAGAACTCGAATTTCACTCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000494
COL17A1 MISSION shRNA Lentiviral Transduction Particles
collagen, type XVII, alpha 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000427473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000494.3-1263s21c1
Sequence:CCGGAGGACAGCGGGAAGGTCTTTACTCGAGTAAAGACCTTCCCGCTGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118937    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000494.2-5374s1c1
Sequence:CCGGGCAATGGACAAGGAAGGAATACTCGAGTATTCCTTCCTTGTCCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000494.2-1381s1c1
Sequence:CCGGCGAAGCTAATGGAGACCTGAACTCGAGTTCAGGTCTCCATTAGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000494.2-2992s1c1
Sequence:CCGGGTCCAGTTCTTTCGGACTCAACTCGAGTTGAGTCCGAAAGAACTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000494.2-2427s1c1
Sequence:CCGGCAAGAGGTGAACAAGGTCTTACTCGAGTAAGACCTTGTTCACCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000494.2-581s1c1
Sequence:CCGGCGAGAGAGTGAAATTCGAGTTCTCGAGAACTCGAATTTCACTCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007732
COL17A1 MISSION shRNA Bacterial Glycerol Stock
collagen, type XVII, alpha 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094529    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007732.1-4963s1c1
Sequence:CCGGCCTTTGTAGATGACGTGTGATCTCGAGATCACACGTCATCTACAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007732.1-3080s1c1
Sequence:CCGGCCTGACTGACTCAGAAACCTTCTCGAGAAGGTTTCTGAGTCAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007732.1-3646s1c1
Sequence:CCGGGCAGACACATTCTCAACTATACTCGAGTATAGTTGAGAATGTGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007732.1-337s1c1
Sequence:CCGGCCGAGAGAATTGTCACGGAAACTCGAGTTTCCGTGACAATTCTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007732.1-908s1c1
Sequence:CCGGCGGAACCTATGATTCAGCAATCTCGAGATTGCTGAATCATAGGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007732
COL17A1 MISSION shRNA shRNA Plasmid DNA
collagen, type XVII, alpha 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094529    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007732.1-4963s1c1
Sequence:CCGGCCTTTGTAGATGACGTGTGATCTCGAGATCACACGTCATCTACAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007732.1-3080s1c1
Sequence:CCGGCCTGACTGACTCAGAAACCTTCTCGAGAAGGTTTCTGAGTCAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007732.1-3646s1c1
Sequence:CCGGGCAGACACATTCTCAACTATACTCGAGTATAGTTGAGAATGTGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007732.1-337s1c1
Sequence:CCGGCCGAGAGAATTGTCACGGAAACTCGAGTTTCCGTGACAATTCTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007732.1-908s1c1
Sequence:CCGGCGGAACCTATGATTCAGCAATCTCGAGATTGCTGAATCATAGGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007732
COL17A1 MISSION shRNA Lentiviral Transduction Particles
collagen, type XVII, alpha 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094529    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007732.1-4963s1c1
Sequence:CCGGCCTTTGTAGATGACGTGTGATCTCGAGATCACACGTCATCTACAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007732.1-3080s1c1
Sequence:CCGGCCTGACTGACTCAGAAACCTTCTCGAGAAGGTTTCTGAGTCAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007732.1-3646s1c1
Sequence:CCGGGCAGACACATTCTCAACTATACTCGAGTATAGTTGAGAATGTGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007732.1-337s1c1
Sequence:CCGGCCGAGAGAATTGTCACGGAAACTCGAGTTTCCGTGACAATTCTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007732.1-908s1c1
Sequence:CCGGCGGAACCTATGATTCAGCAATCTCGAGATTGCTGAATCATAGGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks