EMAIL THIS PAGE TO A FRIEND

COL18A1

collagen, type XVIII, alpha 1

110 Gene Product Result for
Synonyms: KNO KNO1 KS
Gene ID:
Human(80781) Summary: This gene encodes the alpha chain of type XVIII collagen. This collagen is one of the multiplexins, extracellular matrix proteins that contain multiple triple-helix domains (collagenous domains) interrupted by non-collagenous domains. The proteolytically produced C-terminal fragment of type XVIII collagen is endostatin, a potent antiangiogenic protein. Mutations in this gene are associated with Knobloch syndrome. The main features of this syndrome involve retinal abnormalities, so type XVIII collagen may play an important role in retinal structure and in neural tube closure. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2008]
Mouse(12822) collagen, type XVIII, alpha 1
Rat(85251) collagen, type XVIII, alpha 1
Zebrafish(564123) collagen type XVIII, alpha 1
cow(508076) collagen, type XVIII, alpha 1
domestic cat(101086496) collagen, type XVIII, alpha 1
dog(100687767) collagen, type XVIII, alpha 1
dog(100126771) collagen, type XVIII, alpha 1
chicken(373978) collagen, type XVIII, alpha 1
sheep(101106232) collagen, type XVIII, alpha 1
naked mole-rat(101705854) collagen, type XVIII, alpha 1
domestic guinea pig(100733184) collagen, type XVIII, alpha 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030582 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030582 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030582 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009929 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009929 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009929 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030582 Rosetta Predictions human pricing
NM_130444 Rosetta Predictions human pricing
NM_130445 Rosetta Predictions human pricing
XM_001079576 Rosetta Predictions rat pricing
XM_241632 Rosetta Predictions rat pricing
NM_001109991 Rosetta Predictions mouse pricing
NM_009929 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030582 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00193657 predicted 5057
2 SASI_Hs01_00193658 predicted 3033
3 SASI_Hs01_00193659 predicted 1076
4 SASI_Hs01_00193660 predicted 4673
5 SASI_Hs01_00193661 predicted 4839
6 SASI_Hs01_00193662 predicted 3113
7 SASI_Hs01_00193663 predicted 4515
8 SASI_Hs01_00193664 predicted 4672
9 SASI_Hs02_00358154 predicted 1507
10 SASI_Hs02_00358155 predicted 4681
11 SASI_Hs01_00193665 predicted 4933
12 SASI_Hs01_00193666 predicted 1094
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130444 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00197081 predicted 4934
2 SASI_Hs01_00197082 predicted 2915
3 SASI_Hs01_00197083 predicted 1088
4 SASI_Hs01_00197084 predicted 4550
5 SASI_Hs01_00197085 predicted 4724
6 SASI_Hs01_00197086 predicted 2995
7 SASI_Hs01_00197087 predicted 4390
8 SASI_Hs01_00197088 predicted 4539
9 SASI_Hs01_00197089 predicted 4801
10 SASI_Hs01_00197090 predicted 1093
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130445 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00141702 predicted 4543
2 SASI_Hs01_00141703 predicted 2522
3 SASI_Hs01_00141704 predicted 563
4 SASI_Hs01_00141705 predicted 4159
5 SASI_Hs01_00141706 predicted 4332
6 SASI_Hs01_00141707 predicted 2604
7 SASI_Hs01_00141708 predicted 4007
8 SASI_Hs01_00141709 predicted 4159
9 SASI_Hs02_00362744 predicted 1002
10 SASI_Hs02_00362745 predicted 4167
11 SASI_Hs01_00141710 predicted 4416
12 SASI_Hs01_00141711 predicted 579
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001079576 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00364743 predicted 3081
2 SASI_Rn02_00364744 predicted 2403
3 SASI_Rn02_00364745 predicted 380
4 SASI_Rn02_00364746 predicted 2950
5 SASI_Rn02_00364747 predicted 1242
6 SASI_Rn02_00364748 predicted 1033
7 SASI_Rn02_00364749 predicted 2675
8 SASI_Rn02_00364750 predicted 372
9 SASI_Rn02_00364751 predicted 2242
10 SASI_Rn02_00364752 predicted 3255
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_241632 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00391639 predicted 3109
2 SASI_Rn02_00391640 predicted 383
3 SASI_Rn02_00391641 predicted 2979
4 SASI_Rn02_00391642 predicted 1238
5 SASI_Rn02_00391643 predicted 1035
6 SASI_Rn02_00391644 predicted 2692
7 SASI_Rn02_00391645 predicted 373
8 SASI_Rn02_00391646 predicted 2254
9 SASI_Rn02_00391647 predicted 3203
10 SASI_Rn02_00391648 predicted 3278
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109991 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00304534 predicted 4128
2 SASI_Mm02_00304535 predicted 3930
3 SASI_Mm02_00304536 predicted 1163
4 SASI_Mm02_00304537 predicted 3760
5 SASI_Mm02_00304538 predicted 3149
6 SASI_Mm02_00304539 predicted 1163
7 SASI_Mm02_00304540 predicted 1180
8 SASI_Mm02_00304541 predicted 3152
9 SASI_Mm02_00304542 predicted 1121
10 SASI_Mm02_00304543 predicted 3735
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009929 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00148807 predicted 3544
2 SASI_Mm01_00148808 predicted 3349
3 SASI_Mm01_00148809 predicted 577
4 SASI_Mm01_00148810 predicted 3170
5 SASI_Mm01_00148811 predicted 2573
6 SASI_Mm01_00148812 predicted 580
7 SASI_Mm01_00148813 predicted 596
8 SASI_Mm01_00148814 predicted 2574
9 SASI_Mm02_00317472 predicted 544
10 SASI_Mm02_00317473 predicted 3149
11 SASI_Mm01_00148805 predicted 226
12 SASI_Mm01_00148806 predicted 3223
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030582
VALIDATED
COL18A1 MISSION shRNA Bacterial Glycerol Stock
collagen, type XVIII, alpha 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000118802    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030582.2-4672s1c1
Sequence:CCGGGCTGCCATACTTTCCTGTATACTCGAGTATACAGGAAAGTATGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_030582.2-760s1c1
Sequence:CCGGGCCTACGTCTTTGGGCCAGATCTCGAGATCTGGCCCAAAGACGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030582.2-4522s1c1
Sequence:CCGGGCCTACATCGTGCTCTGCATTCTCGAGAATGCAGAGCACGATGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030582.2-3009s1c1
Sequence:CCGGGAACGGATTGAAAGGAGAGAACTCGAGTTCTCTCCTTTCAATCCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_030582.3-3041s21c1
Sequence:CCGGGAGATGCCAGCCTTGGATTTGCTCGAGCAAATCCAAGGCTGGCATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_030582.3-3125s21c1
Sequence:CCGGTTTACGACAGCAATGTGTTTGCTCGAGCAAACACATTGCTGTCGTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299688    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_030582.3-4672s21c1
Sequence:CCGGGCTGCCATACTTTCCTGTATACTCGAGTATACAGGAAAGTATGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030582.3-3009s21c1
Sequence:CCGGGAACGGATTGAAAGGAGAGAACTCGAGTTCTCTCCTTTCAATCCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030582.3-4522s21c1
Sequence:CCGGGCCTACATCGTGCTCTGCATTCTCGAGAATGCAGAGCACGATGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030582
VALIDATED
COL18A1 MISSION shRNA shRNA Plasmid DNA
collagen, type XVIII, alpha 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000118802    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030582.2-4672s1c1
Sequence:CCGGGCTGCCATACTTTCCTGTATACTCGAGTATACAGGAAAGTATGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_030582.2-760s1c1
Sequence:CCGGGCCTACGTCTTTGGGCCAGATCTCGAGATCTGGCCCAAAGACGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030582.2-4522s1c1
Sequence:CCGGGCCTACATCGTGCTCTGCATTCTCGAGAATGCAGAGCACGATGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030582.2-3009s1c1
Sequence:CCGGGAACGGATTGAAAGGAGAGAACTCGAGTTCTCTCCTTTCAATCCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_030582.3-3041s21c1
Sequence:CCGGGAGATGCCAGCCTTGGATTTGCTCGAGCAAATCCAAGGCTGGCATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_030582.3-3125s21c1
Sequence:CCGGTTTACGACAGCAATGTGTTTGCTCGAGCAAACACATTGCTGTCGTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299688    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_030582.3-4672s21c1
Sequence:CCGGGCTGCCATACTTTCCTGTATACTCGAGTATACAGGAAAGTATGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030582.3-3009s21c1
Sequence:CCGGGAACGGATTGAAAGGAGAGAACTCGAGTTCTCTCCTTTCAATCCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030582.3-4522s21c1
Sequence:CCGGGCCTACATCGTGCTCTGCATTCTCGAGAATGCAGAGCACGATGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030582
VALIDATED
COL18A1 MISSION shRNA Lentiviral Transduction Particles
collagen, type XVIII, alpha 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000118802    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030582.2-4672s1c1
Sequence:CCGGGCTGCCATACTTTCCTGTATACTCGAGTATACAGGAAAGTATGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_030582.2-760s1c1
Sequence:CCGGGCCTACGTCTTTGGGCCAGATCTCGAGATCTGGCCCAAAGACGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030582.2-4522s1c1
Sequence:CCGGGCCTACATCGTGCTCTGCATTCTCGAGAATGCAGAGCACGATGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030582.2-3009s1c1
Sequence:CCGGGAACGGATTGAAAGGAGAGAACTCGAGTTCTCTCCTTTCAATCCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_030582.3-3041s21c1
Sequence:CCGGGAGATGCCAGCCTTGGATTTGCTCGAGCAAATCCAAGGCTGGCATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_030582.3-3125s21c1
Sequence:CCGGTTTACGACAGCAATGTGTTTGCTCGAGCAAACACATTGCTGTCGTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299688    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_030582.3-4672s21c1
Sequence:CCGGGCTGCCATACTTTCCTGTATACTCGAGTATACAGGAAAGTATGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030582.3-3009s21c1
Sequence:CCGGGAACGGATTGAAAGGAGAGAACTCGAGTTCTCTCCTTTCAATCCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030582.3-4522s21c1
Sequence:CCGGGCCTACATCGTGCTCTGCATTCTCGAGAATGCAGAGCACGATGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009929
VALIDATED
COL18A1 MISSION shRNA Bacterial Glycerol Stock
collagen, type XVIII, alpha 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000109539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009929.2-888s1c1
Sequence:CCGGGCACCACAGAAGATCCTAGAACTCGAGTTCTAGGATCTTCTGTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009929.2-1413s1c1
Sequence:CCGGGCGGAGACATAGAGAGCCTTACTCGAGTAAGGCTCTCTATGTCTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009929.2-3958s1c1
Sequence:CCGGCCTGTGCATTGAGAATAGCTTCTCGAGAAGCTATTCTCAATGCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009929.2-1808s1c1
Sequence:CCGGGCTGGATTCGATGATATGGAACTCGAGTTCCATATCATCGAATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109535    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009929.2-4087s1c1
Sequence:CCGGGCTGGGATACAATCCTGTATACTCGAGTATACAGGATTGTATCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009929.3-1442s21c1
Sequence:CCGGGCGGAGACATAGAGAGCCTTACTCGAGTAAGGCTCTCTATGTCTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009929.3-1837s21c1
Sequence:CCGGGCTGGATTCGATGATATGGAACTCGAGTTCCATATCATCGAATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009929.3-917s21c1
Sequence:CCGGGCACCACAGAAGATCCTAGAACTCGAGTTCTAGGATCTTCTGTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009929.3-3987s21c1
Sequence:CCGGCCTGTGCATTGAGAATAGCTTCTCGAGAAGCTATTCTCAATGCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326586    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009929.3-4116s21c1
Sequence:CCGGGCTGGGATACAATCCTGTATACTCGAGTATACAGGATTGTATCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009929
VALIDATED
COL18A1 MISSION shRNA shRNA Plasmid DNA
collagen, type XVIII, alpha 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000109539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009929.2-888s1c1
Sequence:CCGGGCACCACAGAAGATCCTAGAACTCGAGTTCTAGGATCTTCTGTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009929.2-1413s1c1
Sequence:CCGGGCGGAGACATAGAGAGCCTTACTCGAGTAAGGCTCTCTATGTCTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009929.2-3958s1c1
Sequence:CCGGCCTGTGCATTGAGAATAGCTTCTCGAGAAGCTATTCTCAATGCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009929.2-1808s1c1
Sequence:CCGGGCTGGATTCGATGATATGGAACTCGAGTTCCATATCATCGAATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109535    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009929.2-4087s1c1
Sequence:CCGGGCTGGGATACAATCCTGTATACTCGAGTATACAGGATTGTATCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009929.3-1442s21c1
Sequence:CCGGGCGGAGACATAGAGAGCCTTACTCGAGTAAGGCTCTCTATGTCTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009929.3-1837s21c1
Sequence:CCGGGCTGGATTCGATGATATGGAACTCGAGTTCCATATCATCGAATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009929.3-917s21c1
Sequence:CCGGGCACCACAGAAGATCCTAGAACTCGAGTTCTAGGATCTTCTGTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009929.3-3987s21c1
Sequence:CCGGCCTGTGCATTGAGAATAGCTTCTCGAGAAGCTATTCTCAATGCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326586    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009929.3-4116s21c1
Sequence:CCGGGCTGGGATACAATCCTGTATACTCGAGTATACAGGATTGTATCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009929
VALIDATED
COL18A1 MISSION shRNA Lentiviral Transduction Particles
collagen, type XVIII, alpha 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000109539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009929.2-888s1c1
Sequence:CCGGGCACCACAGAAGATCCTAGAACTCGAGTTCTAGGATCTTCTGTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009929.2-1413s1c1
Sequence:CCGGGCGGAGACATAGAGAGCCTTACTCGAGTAAGGCTCTCTATGTCTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009929.2-3958s1c1
Sequence:CCGGCCTGTGCATTGAGAATAGCTTCTCGAGAAGCTATTCTCAATGCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009929.2-1808s1c1
Sequence:CCGGGCTGGATTCGATGATATGGAACTCGAGTTCCATATCATCGAATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109535    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009929.2-4087s1c1
Sequence:CCGGGCTGGGATACAATCCTGTATACTCGAGTATACAGGATTGTATCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009929.3-1442s21c1
Sequence:CCGGGCGGAGACATAGAGAGCCTTACTCGAGTAAGGCTCTCTATGTCTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009929.3-1837s21c1
Sequence:CCGGGCTGGATTCGATGATATGGAACTCGAGTTCCATATCATCGAATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009929.3-917s21c1
Sequence:CCGGGCACCACAGAAGATCCTAGAACTCGAGTTCTAGGATCTTCTGTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009929.3-3987s21c1
Sequence:CCGGCCTGTGCATTGAGAATAGCTTCTCGAGAAGCTATTCTCAATGCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326586    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009929.3-4116s21c1
Sequence:CCGGGCTGGGATACAATCCTGTATACTCGAGTATACAGGATTGTATCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks