EMAIL THIS PAGE TO A FRIEND

COL19A1

collagen, type XIX, alpha 1

237 Gene Product Result for
Synonyms: COL9A1L D6S228E
Gene ID:
Human(1310) Summary: This gene encodes the alpha chain of type XIX collagen, a member of the FACIT collagen family (fibril-associated collagens with interrupted helices). Although the function of this collagen is not known, other members of this collagen family are found in association with fibril-forming collagens such as type I and II, and serve to maintain the integrity of the extracellular matrix. The transcript produced from this gene has an unusually large 3' UTR which has not been completely sequenced. [provided by RefSeq, Jul 2008]
Mouse(12823) collagen, type XIX, alpha 1
Rat(367236) collagen, type XIX, alpha 1
Zebrafish(571468) collagen, type XIX, alpha 1
dog(481872) collagen, type XIX, alpha 1
cow(100137749) collagen, type XIX, alpha 1
chicken(421873) collagen, type XIX, alpha 1
domestic guinea pig(100723687) collagen, type XIX, alpha 1
naked mole-rat(101726481) collagen, type XIX, alpha 1
sheep(101103246) collagen, type XIX, alpha 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007733 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007733 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007733 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001858 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001858 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001858 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU038511 MISSION® esiRNA esiRNA human COL19A1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001858 Rosetta Predictions human pricing
XM_001072067 Rosetta Predictions rat pricing
XM_346030 Rosetta Predictions rat pricing
NM_007733 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001858 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00236561 predicted 564
2 SASI_Hs02_00332680 predicted 459
3 SASI_Hs01_00236562 predicted 603
4 SASI_Hs01_00236563 predicted 2612
5 SASI_Hs02_00332681 predicted 1984
6 SASI_Hs01_00236565 predicted 1969
7 SASI_Hs02_00332682 predicted 1521
8 SASI_Hs01_00236568 predicted 627
9 SASI_Hs01_00236569 predicted 836
10 SASI_Hs02_00332683 predicted 901
11 SASI_Hs01_00236564 predicted 548
12 SASI_Hs01_00236566 predicted 2559
13 SASI_Hs01_00236567 predicted 777
14 SASI_Hs01_00236570 predicted 743
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001072067 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00337666 predicted 2064
2 SASI_Rn02_00337667 predicted 738
3 SASI_Rn02_00337668 predicted 3100
4 SASI_Rn02_00337669 predicted 711
5 SASI_Rn02_00337670 predicted 859
6 SASI_Rn02_00337671 predicted 1898
7 SASI_Rn02_00337672 predicted 3093
8 SASI_Rn02_00337673 predicted 2984
9 SASI_Rn02_00337674 predicted 394
10 SASI_Rn02_00337675 predicted 2047
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_346030 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00180850 predicted 978
2 SASI_Rn01_00180851 predicted 967
3 SASI_Rn01_00180852 predicted 2528
4 SASI_Rn01_00180853 predicted 968
5 SASI_Rn01_00180854 predicted 2770
6 SASI_Rn01_00180855 predicted 1148
7 SASI_Rn01_00180856 predicted 3235
8 SASI_Rn01_00180857 predicted 2458
9 SASI_Rn01_00180858 predicted 2737
10 SASI_Rn01_00180859 predicted 650
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007733 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00120391 predicted 660
2 SASI_Mm01_00120392 predicted 1846
3 SASI_Mm01_00120394 predicted 2827
4 SASI_Mm01_00120395 predicted 669
5 SASI_Mm01_00120396 predicted 646
6 SASI_Mm01_00120397 predicted 2200
7 SASI_Mm02_00312325 predicted 1045
8 SASI_Mm01_00120399 predicted 760
9 SASI_Mm02_00312326 predicted 1667
10 SASI_Mm02_00312327 predicted 2919
11 SASI_Mm01_00120390 predicted 2901
12 SASI_Mm01_00120393 predicted 1025
13 SASI_Mm01_00120398 predicted 1499
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007733
COL19A1 MISSION shRNA Bacterial Glycerol Stock
collagen, type XIX, alpha 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000090003    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007733.1-3711s1c1
Sequence:CCGGGCCAACTTCTTTCCATATGTTCTCGAGAACATATGGAAAGAAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007733.1-3183s1c1
Sequence:CCGGGCTGTGTTTCTATCCCAGCTTCTCGAGAAGCTGGGATAGAAACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007733.1-628s1c1
Sequence:CCGGCCCGAGTCCTTTCTCTCTATACTCGAGTATAGAGAGAAAGGACTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007733.1-629s1c1
Sequence:CCGGCCGAGTCCTTTCTCTCTATATCTCGAGATATAGAGAGAAAGGACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007733.1-1023s1c1
Sequence:CCGGCCGGGTGAACATGGCTTAAATCTCGAGATTTAAGCCATGTTCACCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007733
COL19A1 MISSION shRNA shRNA Plasmid DNA
collagen, type XIX, alpha 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000090003    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007733.1-3711s1c1
Sequence:CCGGGCCAACTTCTTTCCATATGTTCTCGAGAACATATGGAAAGAAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007733.1-3183s1c1
Sequence:CCGGGCTGTGTTTCTATCCCAGCTTCTCGAGAAGCTGGGATAGAAACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007733.1-628s1c1
Sequence:CCGGCCCGAGTCCTTTCTCTCTATACTCGAGTATAGAGAGAAAGGACTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007733.1-629s1c1
Sequence:CCGGCCGAGTCCTTTCTCTCTATATCTCGAGATATAGAGAGAAAGGACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007733.1-1023s1c1
Sequence:CCGGCCGGGTGAACATGGCTTAAATCTCGAGATTTAAGCCATGTTCACCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007733
COL19A1 MISSION shRNA Lentiviral Transduction Particles
collagen, type XIX, alpha 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000090003    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007733.1-3711s1c1
Sequence:CCGGGCCAACTTCTTTCCATATGTTCTCGAGAACATATGGAAAGAAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007733.1-3183s1c1
Sequence:CCGGGCTGTGTTTCTATCCCAGCTTCTCGAGAAGCTGGGATAGAAACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007733.1-628s1c1
Sequence:CCGGCCCGAGTCCTTTCTCTCTATACTCGAGTATAGAGAGAAAGGACTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007733.1-629s1c1
Sequence:CCGGCCGAGTCCTTTCTCTCTATATCTCGAGATATAGAGAGAAAGGACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007733.1-1023s1c1
Sequence:CCGGCCGGGTGAACATGGCTTAAATCTCGAGATTTAAGCCATGTTCACCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001858
COL19A1 MISSION shRNA Bacterial Glycerol Stock
collagen, type XIX, alpha 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000117207    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001858.4-5094s1c1
Sequence:CCGGGCCTAATTTAAGGCAGGGTTTCTCGAGAAACCCTGCCTTAAATTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001858.4-2271s1c1
Sequence:CCGGGCCTGGAAAGTATGATTCCATCTCGAGATGGAATCATACTTTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001858.4-943s1c1
Sequence:CCGGCCAGCAAAGCAGGAACTTAAACTCGAGTTTAAGTTCCTGCTTTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001858.4-3142s1c1
Sequence:CCGGCCGGCTGATGCAGTTTCATTTCTCGAGAAATGAAACTGCATCAGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001858.4-1399s1c1
Sequence:CCGGCCTCCTGGAATACAAGGAATACTCGAGTATTCCTTGTATTCCAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001858.4-631s21c1
Sequence:CCGGCACAAACTTGGCATTAGTATACTCGAGTATACTAATGCCAAGTTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001858.4-1422s21c1
Sequence:CCGGCCAAACTCTTGGTGGATATTACTCGAGTAATATCCACCAAGAGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001858
COL19A1 MISSION shRNA shRNA Plasmid DNA
collagen, type XIX, alpha 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000117207    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001858.4-5094s1c1
Sequence:CCGGGCCTAATTTAAGGCAGGGTTTCTCGAGAAACCCTGCCTTAAATTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001858.4-2271s1c1
Sequence:CCGGGCCTGGAAAGTATGATTCCATCTCGAGATGGAATCATACTTTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001858.4-943s1c1
Sequence:CCGGCCAGCAAAGCAGGAACTTAAACTCGAGTTTAAGTTCCTGCTTTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001858.4-3142s1c1
Sequence:CCGGCCGGCTGATGCAGTTTCATTTCTCGAGAAATGAAACTGCATCAGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001858.4-1399s1c1
Sequence:CCGGCCTCCTGGAATACAAGGAATACTCGAGTATTCCTTGTATTCCAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001858.4-631s21c1
Sequence:CCGGCACAAACTTGGCATTAGTATACTCGAGTATACTAATGCCAAGTTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001858.4-1422s21c1
Sequence:CCGGCCAAACTCTTGGTGGATATTACTCGAGTAATATCCACCAAGAGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001858
COL19A1 MISSION shRNA Lentiviral Transduction Particles
collagen, type XIX, alpha 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000117207    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001858.4-5094s1c1
Sequence:CCGGGCCTAATTTAAGGCAGGGTTTCTCGAGAAACCCTGCCTTAAATTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001858.4-2271s1c1
Sequence:CCGGGCCTGGAAAGTATGATTCCATCTCGAGATGGAATCATACTTTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001858.4-943s1c1
Sequence:CCGGCCAGCAAAGCAGGAACTTAAACTCGAGTTTAAGTTCCTGCTTTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001858.4-3142s1c1
Sequence:CCGGCCGGCTGATGCAGTTTCATTTCTCGAGAAATGAAACTGCATCAGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001858.4-1399s1c1
Sequence:CCGGCCTCCTGGAATACAAGGAATACTCGAGTATTCCTTGTATTCCAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001858.4-631s21c1
Sequence:CCGGCACAAACTTGGCATTAGTATACTCGAGTATACTAATGCCAAGTTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001858.4-1422s21c1
Sequence:CCGGCCAAACTCTTGGTGGATATTACTCGAGTAATATCCACCAAGAGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks