EMAIL THIS PAGE TO A FRIEND

COL1A2

collagen, type I, alpha 2

121 Gene Product Result for
Synonyms: OI4
Gene ID:
Human(1278) Summary: This gene encodes the pro-alpha2 chain of type I collagen whose triple helix comprises two alpha1 chains and one alpha2 chain. Type I is a fibril-forming collagen found in most connective tissues and is abundant in bone, cornea, dermis and tendon. Mutations in this gene are associated with osteogenesis imperfecta types I-IV, Ehlers-Danlos syndrome type VIIB, recessive Ehlers-Danlos syndrome Classical type, idiopathic osteoporosis, and atypical Marfan syndrome. Symptoms associated with mutations in this gene, however, tend to be less severe than mutations in the gene for the alpha1 chain of type I collagen (COL1A1) reflecting the different role of alpha2 chains in matrix integrity. Three transcripts, resulting from the use of alternate polyadenylation signals, have been identified for this gene. [provided by R. Dalgleish, Feb 2008]
Mouse(12843) collagen, type I, alpha 2
Rat(84352) collagen, type I, alpha 2
Zebrafish(336471) collagen, type I, alpha 2
cow(282188) collagen, type I, alpha 2
Horse(100051715) collagen, type I, alpha 2
domestic cat(101089428) collagen, type I, alpha 2
dog(403824) collagen, type I, alpha 2
chicken(396243) collagen, type I, alpha 2
domestic guinea pig(100719158) collagen, type I, alpha 2
naked mole-rat(101722393) collagen, type I, alpha 2
Domestic Rabbit(100008997) collagen, type I, alpha 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
G5646 Gly-Arg-Gly-Asp-Thr-Pro ≥97% (HPLC) human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000089 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000089 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000089 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007743 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007743 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007743 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU131521 MISSION® esiRNA esiRNA human COL1A2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000089 Rosetta Predictions human pricing
NM_053356 Rosetta Predictions rat pricing
NM_007743 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000089 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00301848 predicted 1357
2 SASI_Hs01_00119639 predicted 3772
3 SASI_Hs01_00119641 predicted 511
4 SASI_Hs01_00119642 predicted 4038
5 SASI_Hs01_00119643 predicted 4329
6 SASI_Hs01_00119645 predicted 492
7 SASI_Hs01_00119646 predicted 524
8 SASI_Hs01_00119647 predicted 2475
9 SASI_Hs02_00301849 predicted 4343
10 SASI_Hs02_00301850 predicted 1445
11 SASI_Hs01_00119638 predicted 4159
12 SASI_Hs01_00119640 predicted 3866
13 SASI_Hs01_00119644 predicted 3904
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053356 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00068323 predicted 3597
2 SASI_Rn01_00068324 predicted 3402
3 SASI_Rn02_00265824 predicted 3863
4 SASI_Rn01_00068326 predicted 3334
5 SASI_Rn01_00068327 predicted 3443
6 SASI_Rn01_00068328 predicted 3826
7 SASI_Rn01_00068329 predicted 3904
8 SASI_Rn01_00068330 predicted 812
9 SASI_Rn02_00265825 predicted 3680
10 SASI_Rn01_00068331 predicted 3721
11 SASI_Rn01_00068325 predicted 3584
12 SASI_Rn01_00068332 predicted 3687
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007743 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00050123 predicted 699
2 SASI_Mm01_00050124 predicted 3550
3 SASI_Mm02_00312342 predicted 3829
4 SASI_Mm01_00050125 predicted 3843
5 SASI_Mm01_00050126 predicted 3740
6 SASI_Mm01_00050127 predicted 3554
7 SASI_Mm01_00050128 predicted 3708
8 SASI_Mm01_00050129 predicted 3819
9 SASI_Mm01_00050130 predicted 3865
10 SASI_Mm01_00050131 predicted 3587
11 SASI_Mm01_00050132 predicted 3687
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000089
COL1A2 MISSION shRNA Bacterial Glycerol Stock
collagen, type I, alpha 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000082912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000089.2-4196s1c1
Sequence:CCGGCCATGAATTCTTTGTGGACATCTCGAGATGTCCACAAAGAATTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000089.2-3680s1c1
Sequence:CCGGCCCTAACCAAGGATGCACTATCTCGAGATAGTGCATCCTTGGTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000089.2-202s1c1
Sequence:CCGGGCCAATCTTTACAAGAGGAAACTCGAGTTTCCTCTTGTAAAGATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000089.2-1701s1c1
Sequence:CCGGCCAGGTCCTGATGGAAACAATCTCGAGATTGTTTCCATCAGGACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000089.2-191s1c1
Sequence:CCGGCCTAGCAACATGCCAATCTTTCTCGAGAAAGATTGGCATGTTGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000439157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000089.3-3314s21c1
Sequence:CCGGGCGGTTACCCTGGCAATATTGCTCGAGCAATATTGCCAGGGTAACCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413093    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000089.3-4737s21c1
Sequence:CCGGGTGCAATACAGTTTCATTAACCTCGAGGTTAATGAAACTGTATTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435661    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000089.3-4678s21c1
Sequence:CCGGGCACATCTACTTGCTTAAATTCTCGAGAATTTAAGCAAGTAGATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000089
COL1A2 MISSION shRNA shRNA Plasmid DNA
collagen, type I, alpha 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000082912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000089.2-4196s1c1
Sequence:CCGGCCATGAATTCTTTGTGGACATCTCGAGATGTCCACAAAGAATTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000089.2-3680s1c1
Sequence:CCGGCCCTAACCAAGGATGCACTATCTCGAGATAGTGCATCCTTGGTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000089.2-202s1c1
Sequence:CCGGGCCAATCTTTACAAGAGGAAACTCGAGTTTCCTCTTGTAAAGATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000089.2-1701s1c1
Sequence:CCGGCCAGGTCCTGATGGAAACAATCTCGAGATTGTTTCCATCAGGACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000089.2-191s1c1
Sequence:CCGGCCTAGCAACATGCCAATCTTTCTCGAGAAAGATTGGCATGTTGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000439157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000089.3-3314s21c1
Sequence:CCGGGCGGTTACCCTGGCAATATTGCTCGAGCAATATTGCCAGGGTAACCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413093    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000089.3-4737s21c1
Sequence:CCGGGTGCAATACAGTTTCATTAACCTCGAGGTTAATGAAACTGTATTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435661    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000089.3-4678s21c1
Sequence:CCGGGCACATCTACTTGCTTAAATTCTCGAGAATTTAAGCAAGTAGATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000089
COL1A2 MISSION shRNA Lentiviral Transduction Particles
collagen, type I, alpha 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000082912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000089.2-4196s1c1
Sequence:CCGGCCATGAATTCTTTGTGGACATCTCGAGATGTCCACAAAGAATTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000089.2-3680s1c1
Sequence:CCGGCCCTAACCAAGGATGCACTATCTCGAGATAGTGCATCCTTGGTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000089.2-202s1c1
Sequence:CCGGGCCAATCTTTACAAGAGGAAACTCGAGTTTCCTCTTGTAAAGATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000089.2-1701s1c1
Sequence:CCGGCCAGGTCCTGATGGAAACAATCTCGAGATTGTTTCCATCAGGACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000089.2-191s1c1
Sequence:CCGGCCTAGCAACATGCCAATCTTTCTCGAGAAAGATTGGCATGTTGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000439157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000089.3-3314s21c1
Sequence:CCGGGCGGTTACCCTGGCAATATTGCTCGAGCAATATTGCCAGGGTAACCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413093    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000089.3-4737s21c1
Sequence:CCGGGTGCAATACAGTTTCATTAACCTCGAGGTTAATGAAACTGTATTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435661    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000089.3-4678s21c1
Sequence:CCGGGCACATCTACTTGCTTAAATTCTCGAGAATTTAAGCAAGTAGATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007743
VALIDATED
COL1A2 MISSION shRNA Bacterial Glycerol Stock
collagen, type I, alpha 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000090043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007743.1-329s1c1
Sequence:CCGGGCTGCTCAGTATTCTGACAAACTCGAGTTTGTCAGAATACTGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007743.1-3507s1c1
Sequence:CCGGCAACTCTGAAATCTCTCAATACTCGAGTATTGAGAGATTTCAGAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007743.1-3279s1c1
Sequence:CCGGCCGTTGGCAAAGATGGTAGATCTCGAGATCTACCATCTTTGCCAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007743.1-133s1c1
Sequence:CCGGCCTAGCAACATGCCAATATTTCTCGAGAAATATTGGCATGTTGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007743.1-3764s1c1
Sequence:CCGGGCCAACAAGCATGTCTGGTTACTCGAGTAACCAGACATGCTTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007743.2-3571s21c1
Sequence:CCGGCAACTCTGAAATCTCTCAATACTCGAGTATTGAGAGATTTCAGAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007743.2-3705s21c1
Sequence:CCGGCCTAACCAAGGATGTACTATGCTCGAGCATAGTACATCCTTGGTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007743.2-1534s21c1
Sequence:CCGGATGTTGGCCCATCTGGTAAAGCTCGAGCTTTACCAGATGGGCCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007743.2-393s21c1
Sequence:CCGGGCTGCTCAGTATTCTGACAAACTCGAGTTTGTCAGAATACTGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007743
VALIDATED
COL1A2 MISSION shRNA shRNA Plasmid DNA
collagen, type I, alpha 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000090043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007743.1-329s1c1
Sequence:CCGGGCTGCTCAGTATTCTGACAAACTCGAGTTTGTCAGAATACTGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007743.1-3507s1c1
Sequence:CCGGCAACTCTGAAATCTCTCAATACTCGAGTATTGAGAGATTTCAGAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007743.1-3279s1c1
Sequence:CCGGCCGTTGGCAAAGATGGTAGATCTCGAGATCTACCATCTTTGCCAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007743.1-133s1c1
Sequence:CCGGCCTAGCAACATGCCAATATTTCTCGAGAAATATTGGCATGTTGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007743.1-3764s1c1
Sequence:CCGGGCCAACAAGCATGTCTGGTTACTCGAGTAACCAGACATGCTTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007743.2-3571s21c1
Sequence:CCGGCAACTCTGAAATCTCTCAATACTCGAGTATTGAGAGATTTCAGAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007743.2-3705s21c1
Sequence:CCGGCCTAACCAAGGATGTACTATGCTCGAGCATAGTACATCCTTGGTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007743.2-1534s21c1
Sequence:CCGGATGTTGGCCCATCTGGTAAAGCTCGAGCTTTACCAGATGGGCCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007743.2-393s21c1
Sequence:CCGGGCTGCTCAGTATTCTGACAAACTCGAGTTTGTCAGAATACTGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007743
VALIDATED
COL1A2 MISSION shRNA Lentiviral Transduction Particles
collagen, type I, alpha 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000090043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007743.1-329s1c1
Sequence:CCGGGCTGCTCAGTATTCTGACAAACTCGAGTTTGTCAGAATACTGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007743.1-3507s1c1
Sequence:CCGGCAACTCTGAAATCTCTCAATACTCGAGTATTGAGAGATTTCAGAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007743.1-3279s1c1
Sequence:CCGGCCGTTGGCAAAGATGGTAGATCTCGAGATCTACCATCTTTGCCAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007743.1-133s1c1
Sequence:CCGGCCTAGCAACATGCCAATATTTCTCGAGAAATATTGGCATGTTGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007743.1-3764s1c1
Sequence:CCGGGCCAACAAGCATGTCTGGTTACTCGAGTAACCAGACATGCTTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007743.2-3571s21c1
Sequence:CCGGCAACTCTGAAATCTCTCAATACTCGAGTATTGAGAGATTTCAGAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007743.2-3705s21c1
Sequence:CCGGCCTAACCAAGGATGTACTATGCTCGAGCATAGTACATCCTTGGTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007743.2-1534s21c1
Sequence:CCGGATGTTGGCCCATCTGGTAAAGCTCGAGCTTTACCAGATGGGCCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007743.2-393s21c1
Sequence:CCGGGCTGCTCAGTATTCTGACAAACTCGAGTTTGTCAGAATACTGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks