EMAIL THIS PAGE TO A FRIEND

COL20A1

collagen, type XX, alpha 1

139 Gene Product Result for
Synonyms: bA261N11.4
Gene ID:
Mouse(73368) collagen, type XX, alpha 1
Rat(311716) collagen, type XX, alpha 1
chicken(419243) collagen, type XX, alpha 1
domestic cat(101101555) collagen, type XX, alpha 1
cow(519501) collagen, type XX, alpha 1
dog(485971) collagen, type XX, alpha 1
sheep(101112800) collagen, type XX, alpha 1
naked mole-rat(101714112) collagen, type XX, alpha 1
domestic guinea pig(100717152) collagen, type XX, alpha 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_181390 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_181390 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_181390 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020882 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020882 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020882 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU141271 MISSION® esiRNA esiRNA human COL20A1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020882 Rosetta Predictions human pricing
XM_001058131 Rosetta Predictions rat pricing
XM_230973 Rosetta Predictions rat pricing
XM_001473208 Rosetta Predictions mouse pricing
XM_181390 Rosetta Predictions mouse pricing
XM_914804 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020882 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00044584 predicted 294
2 SASI_Hs01_00044585 predicted 359
3 SASI_Hs01_00044587 predicted 1018
4 SASI_Hs01_00044588 predicted 1412
5 SASI_Hs02_00354182 predicted 1529
6 SASI_Hs02_00354183 predicted 3186
7 SASI_Hs01_00044589 predicted 373
8 SASI_Hs01_00044590 predicted 1681
9 SASI_Hs01_00044592 predicted 662
10 SASI_Hs01_00044593 predicted 2005
11 SASI_Hs01_00044586 predicted 3039
12 SASI_Hs01_00044591 predicted 318
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058131 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00288686 predicted 3376
2 SASI_Rn02_00288687 predicted 2792
3 SASI_Rn02_00288688 predicted 724
4 SASI_Rn02_00288689 predicted 829
5 SASI_Rn02_00288690 predicted 2680
6 SASI_Rn02_00288691 predicted 2849
7 SASI_Rn02_00288692 predicted 1968
8 SASI_Rn02_00288693 predicted 1077
9 SASI_Rn02_00288694 predicted 2917
10 SASI_Rn02_00288695 predicted 338
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_230973 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00386602 predicted 3573
2 SASI_Rn02_00386603 predicted 1401
3 SASI_Rn02_00386604 predicted 919
4 SASI_Rn02_00386605 predicted 1638
5 SASI_Rn02_00386606 predicted 1028
6 SASI_Rn02_00386607 predicted 883
7 SASI_Rn02_00386608 predicted 3719
8 SASI_Rn02_00386609 predicted 1503
9 SASI_Rn02_00386610 predicted 516
10 SASI_Rn02_00386611 predicted 1281
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001473208 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00366704 predicted 3076
2 SASI_Mm02_00366705 predicted 1208
3 SASI_Mm02_00366706 predicted 2796
4 SASI_Mm02_00366707 predicted 2000
5 SASI_Mm02_00366708 predicted 1082
6 SASI_Mm02_00366709 predicted 827
7 SASI_Mm02_00366710 predicted 3094
8 SASI_Mm02_00366711 predicted 1308
9 SASI_Mm02_00366712 predicted 2920
10 SASI_Mm02_00366713 predicted 898
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_181390 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00264228 predicted 766
2 SASI_Mm01_00264229 predicted 3866
3 SASI_Mm01_00264230 predicted 1218
4 SASI_Mm01_00264231 predicted 2003
5 SASI_Mm01_00264232 predicted 688
6 SASI_Mm01_00264233 predicted 1088
7 SASI_Mm01_00264234 predicted 835
8 SASI_Mm01_00264235 predicted 1316
9 SASI_Mm01_00264236 predicted 902
10 SASI_Mm01_00264237 predicted 3721
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_914804 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00438913 predicted 3078
2 SASI_Mm02_00438914 predicted 1215
3 SASI_Mm02_00438915 predicted 2793
4 SASI_Mm02_00438916 predicted 1994
5 SASI_Mm02_00438917 predicted 1086
6 SASI_Mm02_00438918 predicted 829
7 SASI_Mm02_00438919 predicted 3089
8 SASI_Mm02_00438920 predicted 1308
9 SASI_Mm02_00438921 predicted 2919
10 SASI_Mm02_00438922 predicted 896
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_181390
COL20A1 MISSION shRNA Bacterial Glycerol Stock
collagen, type XX, alpha 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000090473    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_181390.3-3729s1c1
Sequence:CCGGCCCAGCACCATCATCCATAATCTCGAGATTATGGATGATGGTGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_181390.3-1727s1c1
Sequence:CCGGCCTTGTCTGGTGTACTTGTTTCTCGAGAAACAAGTACACCAGACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_181390.3-1205s1c1
Sequence:CCGGCCCTCAAGTATCTAATTGTATCTCGAGATACAATTAGATACTTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_181390.3-2652s1c1
Sequence:CCGGCCACTCTAAGGTCAGACTCTACTCGAGTAGAGTCTGACCTTAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_181390.3-601s1c1
Sequence:CCGGGCCAGCATCATCACACAATTTCTCGAGAAATTGTGTGATGATGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_181390
COL20A1 MISSION shRNA shRNA Plasmid DNA
collagen, type XX, alpha 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000090473    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_181390.3-3729s1c1
Sequence:CCGGCCCAGCACCATCATCCATAATCTCGAGATTATGGATGATGGTGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_181390.3-1727s1c1
Sequence:CCGGCCTTGTCTGGTGTACTTGTTTCTCGAGAAACAAGTACACCAGACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_181390.3-1205s1c1
Sequence:CCGGCCCTCAAGTATCTAATTGTATCTCGAGATACAATTAGATACTTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_181390.3-2652s1c1
Sequence:CCGGCCACTCTAAGGTCAGACTCTACTCGAGTAGAGTCTGACCTTAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_181390.3-601s1c1
Sequence:CCGGGCCAGCATCATCACACAATTTCTCGAGAAATTGTGTGATGATGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_181390
COL20A1 MISSION shRNA Lentiviral Transduction Particles
collagen, type XX, alpha 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000090473    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_181390.3-3729s1c1
Sequence:CCGGCCCAGCACCATCATCCATAATCTCGAGATTATGGATGATGGTGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_181390.3-1727s1c1
Sequence:CCGGCCTTGTCTGGTGTACTTGTTTCTCGAGAAACAAGTACACCAGACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_181390.3-1205s1c1
Sequence:CCGGCCCTCAAGTATCTAATTGTATCTCGAGATACAATTAGATACTTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_181390.3-2652s1c1
Sequence:CCGGCCACTCTAAGGTCAGACTCTACTCGAGTAGAGTCTGACCTTAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_181390.3-601s1c1
Sequence:CCGGGCCAGCATCATCACACAATTTCTCGAGAAATTGTGTGATGATGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020882
COL20A1 MISSION shRNA Bacterial Glycerol Stock
collagen, type XX, alpha 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000116862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020882.1-1316s1c1
Sequence:CCGGCCCTCAAGTATCTGATCGTTTCTCGAGAAACGATCAGATACTTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020882.1-3723s1c1
Sequence:CCGGCGTGTCAAAGTTCGACTCCTTCTCGAGAAGGAGTCGAACTTTGACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020882.1-2409s1c1
Sequence:CCGGGCTCCATTACTGGCTCACCTACTCGAGTAGGTGAGCCAGTAATGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020882.1-2980s1c1
Sequence:CCGGCCGCAGGAAGTGAGGAAGATTCTCGAGAATCTTCCTCACTTCCTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020882.1-2721s1c1
Sequence:CCGGCCCGACCTTCACGCTCTTCAACTCGAGTTGAAGAGCGTGAAGGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020882
COL20A1 MISSION shRNA shRNA Plasmid DNA
collagen, type XX, alpha 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000116862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020882.1-1316s1c1
Sequence:CCGGCCCTCAAGTATCTGATCGTTTCTCGAGAAACGATCAGATACTTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020882.1-3723s1c1
Sequence:CCGGCGTGTCAAAGTTCGACTCCTTCTCGAGAAGGAGTCGAACTTTGACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020882.1-2409s1c1
Sequence:CCGGGCTCCATTACTGGCTCACCTACTCGAGTAGGTGAGCCAGTAATGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020882.1-2980s1c1
Sequence:CCGGCCGCAGGAAGTGAGGAAGATTCTCGAGAATCTTCCTCACTTCCTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020882.1-2721s1c1
Sequence:CCGGCCCGACCTTCACGCTCTTCAACTCGAGTTGAAGAGCGTGAAGGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020882
COL20A1 MISSION shRNA Lentiviral Transduction Particles
collagen, type XX, alpha 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000116862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020882.1-1316s1c1
Sequence:CCGGCCCTCAAGTATCTGATCGTTTCTCGAGAAACGATCAGATACTTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020882.1-3723s1c1
Sequence:CCGGCGTGTCAAAGTTCGACTCCTTCTCGAGAAGGAGTCGAACTTTGACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020882.1-2409s1c1
Sequence:CCGGGCTCCATTACTGGCTCACCTACTCGAGTAGGTGAGCCAGTAATGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020882.1-2980s1c1
Sequence:CCGGCCGCAGGAAGTGAGGAAGATTCTCGAGAATCTTCCTCACTTCCTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020882.1-2721s1c1
Sequence:CCGGCCCGACCTTCACGCTCTTCAACTCGAGTTGAAGAGCGTGAAGGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks