EMAIL THIS PAGE TO A FRIEND

COL21A1

collagen, type XXI, alpha 1

85 Gene Product Result for
Synonyms: COLA1L dJ682J15.1 dJ708F5.1
Gene ID:
Human(81578) Summary: This gene encodes the alpha chain of type XXI collagen, a member of the FACIT collagen family (fibril-associated collagens with interrupted helices). Type XXI collagen is localized to tissues containing type I collagen so, like other members of this collagen family, it may serve to maintain the integrity of the extracellular matrix. An alternatively spliced transcript variant has been described, but its full-length nature has yet to be determined. [provided by RefSeq, Jul 2008]
domestic guinea pig(100729500) collagen, type XXI, alpha 1
naked mole-rat(101725022) collagen, type XXI, alpha 1
sheep(101106802) collagen, type XXI, alpha 1
chicken(421885) collagen, type XXI, alpha 1
cow(533456) collagen, type XXI, alpha 1
Horse(100056839) collagen, type XXI, alpha 1
domestic cat(101097726) collagen, type XXI, alpha 1
dog(474945) collagen, type XXI, alpha 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030820 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030820 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030820 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU137601 MISSION® esiRNA esiRNA human COL21A1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030820 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030820 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00058461 predicted 1136
2 SASI_Hs01_00058462 predicted 435
3 SASI_Hs01_00058463 predicted 1280
4 SASI_Hs01_00058464 predicted 1303
5 SASI_Hs02_00358406 predicted 1375
6 SASI_Hs01_00058465 predicted 1151
7 SASI_Hs02_00358407 predicted 1527
8 SASI_Hs01_00058467 predicted 2606
9 SASI_Hs01_00058468 predicted 2645
10 SASI_Hs01_00058469 predicted 308
11 SASI_Hs01_00058466 predicted 1081
12 SASI_Hs01_00058470 predicted 479
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030820
VALIDATED
COL21A1 MISSION shRNA Bacterial Glycerol Stock
collagen, type XXI, alpha 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000116897    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030820.2-3260s1c1
Sequence:CCGGCCCTTGGATTAGCAGCATTAACTCGAGTTAATGCTGCTAATCCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030820.2-1210s1c1
Sequence:CCGGCCCTCAAGTTAAGACGTTGTTCTCGAGAACAACGTCTTAACTTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030820.2-1211s1c1
Sequence:CCGGCCTCAAGTTAAGACGTTGTTTCTCGAGAAACAACGTCTTAACTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030820.2-751s1c1
Sequence:CCGGGCCTTCGTCTACTTATGTGTTCTCGAGAACACATAAGTAGACGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_030820.2-2105s1c1
Sequence:CCGGCCTGGTTTAATGGGAAGCAATCTCGAGATTGCTTCCCATTAAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030820.3-1197s21c1
Sequence:CCGGTTACAACAACCAGCGTAATTACTCGAGTAATTACGCTGGTTGTTGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030820.3-325s21c1
Sequence:CCGGTCGTACTGCTCCGACAGATTTCTCGAGAAATCTGTCGGAGCAGTACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030820.3-1951s21c1
Sequence:CCGGACATGGAAAGGATGGATTAATCTCGAGATTAATCCATCCTTTCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030820
VALIDATED
COL21A1 MISSION shRNA shRNA Plasmid DNA
collagen, type XXI, alpha 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000116897    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030820.2-3260s1c1
Sequence:CCGGCCCTTGGATTAGCAGCATTAACTCGAGTTAATGCTGCTAATCCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030820.2-1210s1c1
Sequence:CCGGCCCTCAAGTTAAGACGTTGTTCTCGAGAACAACGTCTTAACTTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030820.2-1211s1c1
Sequence:CCGGCCTCAAGTTAAGACGTTGTTTCTCGAGAAACAACGTCTTAACTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030820.2-751s1c1
Sequence:CCGGGCCTTCGTCTACTTATGTGTTCTCGAGAACACATAAGTAGACGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_030820.2-2105s1c1
Sequence:CCGGCCTGGTTTAATGGGAAGCAATCTCGAGATTGCTTCCCATTAAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030820.3-1197s21c1
Sequence:CCGGTTACAACAACCAGCGTAATTACTCGAGTAATTACGCTGGTTGTTGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030820.3-325s21c1
Sequence:CCGGTCGTACTGCTCCGACAGATTTCTCGAGAAATCTGTCGGAGCAGTACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030820.3-1951s21c1
Sequence:CCGGACATGGAAAGGATGGATTAATCTCGAGATTAATCCATCCTTTCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030820
VALIDATED
COL21A1 MISSION shRNA Lentiviral Transduction Particles
collagen, type XXI, alpha 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000116897    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030820.2-3260s1c1
Sequence:CCGGCCCTTGGATTAGCAGCATTAACTCGAGTTAATGCTGCTAATCCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030820.2-1210s1c1
Sequence:CCGGCCCTCAAGTTAAGACGTTGTTCTCGAGAACAACGTCTTAACTTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030820.2-1211s1c1
Sequence:CCGGCCTCAAGTTAAGACGTTGTTTCTCGAGAAACAACGTCTTAACTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030820.2-751s1c1
Sequence:CCGGGCCTTCGTCTACTTATGTGTTCTCGAGAACACATAAGTAGACGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_030820.2-2105s1c1
Sequence:CCGGCCTGGTTTAATGGGAAGCAATCTCGAGATTGCTTCCCATTAAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030820.3-1197s21c1
Sequence:CCGGTTACAACAACCAGCGTAATTACTCGAGTAATTACGCTGGTTGTTGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030820.3-325s21c1
Sequence:CCGGTCGTACTGCTCCGACAGATTTCTCGAGAAATCTGTCGGAGCAGTACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030820.3-1951s21c1
Sequence:CCGGACATGGAAAGGATGGATTAATCTCGAGATTAATCCATCCTTTCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks