EMAIL THIS PAGE TO A FRIEND

COL22A1

collagen, type XXII, alpha 1

86 Gene Product Result for
UniProtKB ID: Q8NFW1, B7ZMH0, C9K0G4, Q8IVT9
Gene ID:
Human(169044) Summary: COL22A1, a member of the FACIT (fibrillar-associated collagens with interrupted triple helices) subgroup of the collagen protein family, specifically localizes to tissue junctions (Koch et al., 2004 [PubMed 15016833]
Mouse(69700) collagen, type XXII, alpha 1
Rat(315071) collagen, type XXII, alpha 1
chicken(420315) collagen, type XXII, alpha 1
domestic cat(101084169) collagen, type XXII, alpha 1
cow(521058) collagen, type XXII, alpha 1
Horse(100069427) collagen, type XXII, alpha 1
dog(482056) collagen, type XXII, alpha 1
sheep(101119401) collagen, type XXII, alpha 1
Domestic Rabbit(100337883) collagen, type XXII, alpha 1
naked mole-rat(101716192) collagen, type XXII, alpha 1
domestic guinea pig(101787089) collagen, type XXII, alpha 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152888 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152888 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152888 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_193814 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_193814 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_193814 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152888 Rosetta Predictions human pricing
XM_001072793 Rosetta Predictions rat pricing
XM_243609 Rosetta Predictions rat pricing
XM_907370 Rosetta Predictions mouse pricing
XM_981846 Rosetta Predictions mouse pricing
XM_981889 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152888 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00111964 predicted 3770
2 SASI_Hs01_00111965 predicted 1700
3 SASI_Hs01_00111966 predicted 1703
4 SASI_Hs01_00111967 predicted 1042
5 SASI_Hs02_00366852 predicted 1335
6 SASI_Hs01_00111968 predicted 1834
7 SASI_Hs01_00111969 predicted 1647
8 SASI_Hs01_00111970 predicted 3759
9 SASI_Hs01_00111972 predicted 2996
10 SASI_Hs01_00111973 predicted 4908
11 SASI_Hs01_00111971 predicted 3985
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001072793 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00340507 predicted 4951
2 SASI_Rn02_00340508 predicted 4441
3 SASI_Rn02_00340509 predicted 316
4 SASI_Rn02_00340510 predicted 942
5 SASI_Rn02_00340511 predicted 1271
6 SASI_Rn02_00340512 predicted 1884
7 SASI_Rn02_00340513 predicted 1315
8 SASI_Rn02_00340514 predicted 1312
9 SASI_Rn02_00340515 predicted 1035
10 SASI_Rn02_00340516 predicted 1157
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_243609 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00391749 predicted 314
2 SASI_Rn02_00391750 predicted 943
3 SASI_Rn02_00391751 predicted 1272
4 SASI_Rn02_00391752 predicted 1883
5 SASI_Rn02_00391753 predicted 1315
6 SASI_Rn02_00391754 predicted 1304
7 SASI_Rn02_00391755 predicted 1034
8 SASI_Rn02_00391756 predicted 784
9 SASI_Rn02_00391757 predicted 1158
10 SASI_Rn02_00391758 predicted 921
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_907370 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00433277 predicted 1552
2 SASI_Mm02_00433278 predicted 2457
3 SASI_Mm02_00433279 predicted 1320
4 SASI_Mm02_00433280 predicted 465
5 SASI_Mm02_00433281 predicted 3688
6 SASI_Mm02_00433282 predicted 1688
7 SASI_Mm02_00433283 predicted 1423
8 SASI_Mm02_00433284 predicted 1697
9 SASI_Mm02_00433285 predicted 1140
10 SASI_Mm02_00433286 predicted 1308
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_981846 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00221794 predicted 582
2 SASI_Mm01_00221795 predicted 1115
3 SASI_Mm01_00221796 predicted 396
4 SASI_Mm01_00221797 predicted 1161
5 SASI_Mm01_00221798 predicted 1057
6 SASI_Mm01_00221799 predicted 1098
7 SASI_Mm01_00221800 predicted 1036
8 SASI_Mm01_00221801 predicted 1263
9 SASI_Mm01_00221802 predicted 1548
10 SASI_Mm01_00221803 predicted 1528
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_981889 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00219205 predicted 1552
2 SASI_Mm01_00219206 predicted 2452
3 SASI_Mm01_00219207 predicted 1327
4 SASI_Mm01_00219208 predicted 458
5 SASI_Mm01_00219209 predicted 3695
6 SASI_Mm01_00219210 predicted 1687
7 SASI_Mm01_00219211 predicted 1424
8 SASI_Mm01_00219212 predicted 1694
9 SASI_Mm01_00219213 predicted 1137
10 SASI_Mm01_00219214 predicted 1306
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152888
COL22A1 MISSION shRNA Bacterial Glycerol Stock
collagen, type XXII, alpha 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000244095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152888.1-5309s21c1
Sequence:CCGGGTAATGTGAAGGGTCCCTAAACTCGAGTTTAGGGACCCTTCACATTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152888.1-4831s21c1
Sequence:CCGGGAAACCCTGCGTCGGCTTATTCTCGAGAATAAGCCGACGCAGGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152888.1-5150s21c1
Sequence:CCGGGGGAACCTGGCTATGCTAAAGCTCGAGCTTTAGCATAGCCAGGTTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244096    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152888.1-5509s21c1
Sequence:CCGGTGCCGGTCGGTCAGATTATTACTCGAGTAATAATCTGACCGACCGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152888.1-3498s21c1
Sequence:CCGGACTGGGAGGGCAATGTGTTAACTCGAGTTAACACATTGCCCTCCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168474    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152888.1-5152s1c1
Sequence:CCGGGAACCTGGCTATGCTAAAGATCTCGAGATCTTTAGCATAGCCAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168337    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152888.1-1138s1c1
Sequence:CCGGGATCGCTTTAAGCACACCAATCTCGAGATTGGTGTGCTTAAAGCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172849    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152888.1-1247s1c1
Sequence:CCGGGTTCCTATGTACGGATGGGATCTCGAGATCCCATCCGTACATAGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152888
COL22A1 MISSION shRNA shRNA Plasmid DNA
collagen, type XXII, alpha 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000244095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152888.1-5309s21c1
Sequence:CCGGGTAATGTGAAGGGTCCCTAAACTCGAGTTTAGGGACCCTTCACATTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152888.1-4831s21c1
Sequence:CCGGGAAACCCTGCGTCGGCTTATTCTCGAGAATAAGCCGACGCAGGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152888.1-5150s21c1
Sequence:CCGGGGGAACCTGGCTATGCTAAAGCTCGAGCTTTAGCATAGCCAGGTTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244096    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152888.1-5509s21c1
Sequence:CCGGTGCCGGTCGGTCAGATTATTACTCGAGTAATAATCTGACCGACCGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152888.1-3498s21c1
Sequence:CCGGACTGGGAGGGCAATGTGTTAACTCGAGTTAACACATTGCCCTCCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168474    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152888.1-5152s1c1
Sequence:CCGGGAACCTGGCTATGCTAAAGATCTCGAGATCTTTAGCATAGCCAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168337    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152888.1-1138s1c1
Sequence:CCGGGATCGCTTTAAGCACACCAATCTCGAGATTGGTGTGCTTAAAGCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172849    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152888.1-1247s1c1
Sequence:CCGGGTTCCTATGTACGGATGGGATCTCGAGATCCCATCCGTACATAGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152888
COL22A1 MISSION shRNA Lentiviral Transduction Particles
collagen, type XXII, alpha 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000244095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152888.1-5309s21c1
Sequence:CCGGGTAATGTGAAGGGTCCCTAAACTCGAGTTTAGGGACCCTTCACATTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152888.1-4831s21c1
Sequence:CCGGGAAACCCTGCGTCGGCTTATTCTCGAGAATAAGCCGACGCAGGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152888.1-5150s21c1
Sequence:CCGGGGGAACCTGGCTATGCTAAAGCTCGAGCTTTAGCATAGCCAGGTTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244096    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152888.1-5509s21c1
Sequence:CCGGTGCCGGTCGGTCAGATTATTACTCGAGTAATAATCTGACCGACCGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152888.1-3498s21c1
Sequence:CCGGACTGGGAGGGCAATGTGTTAACTCGAGTTAACACATTGCCCTCCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168474    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152888.1-5152s1c1
Sequence:CCGGGAACCTGGCTATGCTAAAGATCTCGAGATCTTTAGCATAGCCAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168337    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152888.1-1138s1c1
Sequence:CCGGGATCGCTTTAAGCACACCAATCTCGAGATTGGTGTGCTTAAAGCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172849    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152888.1-1247s1c1
Sequence:CCGGGTTCCTATGTACGGATGGGATCTCGAGATCCCATCCGTACATAGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_193814
COL22A1 MISSION shRNA Bacterial Glycerol Stock
collagen, type XXII, alpha 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000091166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_193814.4-2429s1c1
Sequence:CCGGGCTAGTACTGATGATCACCTTCTCGAGAAGGTGATCATCAGTACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_193814.4-2302s1c1
Sequence:CCGGGCCTCAGCTCTTCTATAAATACTCGAGTATTTATAGAAGAGCTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_193814.4-755s1c1
Sequence:CCGGGCAGCAGTTCTTAGCTTGCATCTCGAGATGCAAGCTAAGAACTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_193814.4-957s1c1
Sequence:CCGGCGAACCTGCAAATACTCAGAACTCGAGTTCTGAGTATTTGCAGGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_193814.4-914s1c1
Sequence:CCGGCCCTTGGATGTTCTCAGATGACTCGAGTCATCTGAGAACATCCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_193814
COL22A1 MISSION shRNA shRNA Plasmid DNA
collagen, type XXII, alpha 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000091166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_193814.4-2429s1c1
Sequence:CCGGGCTAGTACTGATGATCACCTTCTCGAGAAGGTGATCATCAGTACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_193814.4-2302s1c1
Sequence:CCGGGCCTCAGCTCTTCTATAAATACTCGAGTATTTATAGAAGAGCTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_193814.4-755s1c1
Sequence:CCGGGCAGCAGTTCTTAGCTTGCATCTCGAGATGCAAGCTAAGAACTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_193814.4-957s1c1
Sequence:CCGGCGAACCTGCAAATACTCAGAACTCGAGTTCTGAGTATTTGCAGGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_193814.4-914s1c1
Sequence:CCGGCCCTTGGATGTTCTCAGATGACTCGAGTCATCTGAGAACATCCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_193814
COL22A1 MISSION shRNA Lentiviral Transduction Particles
collagen, type XXII, alpha 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000091166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_193814.4-2429s1c1
Sequence:CCGGGCTAGTACTGATGATCACCTTCTCGAGAAGGTGATCATCAGTACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_193814.4-2302s1c1
Sequence:CCGGGCCTCAGCTCTTCTATAAATACTCGAGTATTTATAGAAGAGCTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_193814.4-755s1c1
Sequence:CCGGGCAGCAGTTCTTAGCTTGCATCTCGAGATGCAAGCTAAGAACTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_193814.4-957s1c1
Sequence:CCGGCGAACCTGCAAATACTCAGAACTCGAGTTCTGAGTATTTGCAGGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_193814.4-914s1c1
Sequence:CCGGCCCTTGGATGTTCTCAGATGACTCGAGTCATCTGAGAACATCCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks