EMAIL THIS PAGE TO A FRIEND

COL23A1

collagen, type XXIII, alpha 1

62 Gene Product Result for
UniProtKB ID: Q86Y22, Q8IVR4, Q9NT93
Gene ID:
Human(91522) Summary: COL23A1 is a member of the transmembrane collagens, a subfamily of the nonfibrillar collagens that contain a single pass hydrophobic transmembrane domain (Banyard et al., 2003 [PubMed 12644459]
Mouse(237759) collagen, type XXIII, alpha 1
Rat(353303) collagen, type XXIII, alpha 1
domestic guinea pig(100724055) collagen, type XXIII, alpha 1
naked mole-rat(101708942) collagen, type XXIII, alpha 1
sheep(101108307) collagen, type XXIII, alpha 1
chicken(425481) collagen, type XXIII, alpha 1
cow(613347) collagen, type XXIII, alpha 1
dog(607556) collagen, type XXIII, alpha 1
domestic cat(101098427) collagen, type XXIII, alpha 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153393 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153393 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153393 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_173465 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173465 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173465 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173465 Rosetta Predictions human pricing
NM_181636 Rosetta Predictions rat pricing
NM_153393 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173465 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00199564 predicted 2131
2 SASI_Hs01_00199565 predicted 2281
3 SASI_Hs01_00199566 predicted 2294
4 SASI_Hs01_00199567 predicted 2125
5 SASI_Hs01_00199568 predicted 2308
6 SASI_Hs01_00199569 predicted 2360
7 SASI_Hs01_00199570 predicted 2353
8 SASI_Hs01_00199571 predicted 2298
9 SASI_Hs01_00199572 predicted 1993
10 SASI_Hs01_00199573 predicted 2199
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181636 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00048011 predicted 788
2 SASI_Rn01_00048012 predicted 2186
3 SASI_Rn01_00048013 predicted 1287
4 SASI_Rn01_00048014 predicted 1704
5 SASI_Rn01_00048015 predicted 1821
6 SASI_Rn01_00048016 predicted 2048
7 SASI_Rn01_00048017 predicted 1405
8 SASI_Rn01_00048018 predicted 533
9 SASI_Rn02_00269778 predicted 1819
10 SASI_Rn01_00048019 predicted 1109
11 SASI_Rn01_00048020 predicted 2059
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153393 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00042745 predicted 1089
2 SASI_Mm01_00042746 predicted 2033
3 SASI_Mm01_00042748 predicted 1906
4 SASI_Mm01_00042749 predicted 1353
5 SASI_Mm02_00343171 predicted 1505
6 SASI_Mm01_00042750 predicted 1991
7 SASI_Mm01_00042751 predicted 616
8 SASI_Mm01_00042752 predicted 2265
9 SASI_Mm01_00042753 predicted 1831
10 SASI_Mm02_00343172 predicted 1900
11 SASI_Mm01_00042744 predicted 1907
12 SASI_Mm01_00042747 predicted 1490
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153393
COL23A1 MISSION shRNA Bacterial Glycerol Stock
collagen, type XXIII, alpha 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000119427    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153393.1-2161s1c1
Sequence:CCGGCCAGCTTCTCACTGTCCAATACTCGAGTATTGGACAGTGAGAAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153393.1-1656s1c1
Sequence:CCGGCCGAAGTGAACGTGGAGAGAACTCGAGTTCTCTCCACGTTCACTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153393.1-586s1c1
Sequence:CCGGCCAGGGCAATCAGGACGAGATCTCGAGATCTCGTCCTGATTGCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153393.1-1121s1c1
Sequence:CCGGGCAGGATCTTAGATGCCCTAACTCGAGTTAGGGCATCTAAGATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153393.1-453s1c1
Sequence:CCGGGCGTCTGTTACGGGAGAAGTTCTCGAGAACTTCTCCCGTAACAGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153393
COL23A1 MISSION shRNA shRNA Plasmid DNA
collagen, type XXIII, alpha 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000119427    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153393.1-2161s1c1
Sequence:CCGGCCAGCTTCTCACTGTCCAATACTCGAGTATTGGACAGTGAGAAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153393.1-1656s1c1
Sequence:CCGGCCGAAGTGAACGTGGAGAGAACTCGAGTTCTCTCCACGTTCACTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153393.1-586s1c1
Sequence:CCGGCCAGGGCAATCAGGACGAGATCTCGAGATCTCGTCCTGATTGCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153393.1-1121s1c1
Sequence:CCGGGCAGGATCTTAGATGCCCTAACTCGAGTTAGGGCATCTAAGATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153393.1-453s1c1
Sequence:CCGGGCGTCTGTTACGGGAGAAGTTCTCGAGAACTTCTCCCGTAACAGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153393
COL23A1 MISSION shRNA Lentiviral Transduction Particles
collagen, type XXIII, alpha 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000119427    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153393.1-2161s1c1
Sequence:CCGGCCAGCTTCTCACTGTCCAATACTCGAGTATTGGACAGTGAGAAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153393.1-1656s1c1
Sequence:CCGGCCGAAGTGAACGTGGAGAGAACTCGAGTTCTCTCCACGTTCACTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153393.1-586s1c1
Sequence:CCGGCCAGGGCAATCAGGACGAGATCTCGAGATCTCGTCCTGATTGCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153393.1-1121s1c1
Sequence:CCGGGCAGGATCTTAGATGCCCTAACTCGAGTTAGGGCATCTAAGATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153393.1-453s1c1
Sequence:CCGGGCGTCTGTTACGGGAGAAGTTCTCGAGAACTTCTCCCGTAACAGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173465
COL23A1 MISSION shRNA Bacterial Glycerol Stock
collagen, type XXIII, alpha 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000258013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173465.3-1272s21c1
Sequence:CCGGACACAGTGGTGATCGACTATGCTCGAGCATAGTCGATCACCACTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173465.3-1784s21c1
Sequence:CCGGGAGCCAGGACTAGATGGTTTCCTCGAGGAAACCATCTAGTCCTGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173465.3-688s21c1
Sequence:CCGGGGAAGCTCCATCCGAATGTGTCTCGAGACACATTCGGATGGAGCTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250116    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173465.3-2546s21c1
Sequence:CCGGGGGTCTAGCTCTACCACATTCCTCGAGGAATGTGGTAGAGCTAGACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173465.3-655s21c1
Sequence:CCGGGTTGGACGGACTAGCGAAGATCTCGAGATCTTCGCTAGTCCGTCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173465
COL23A1 MISSION shRNA shRNA Plasmid DNA
collagen, type XXIII, alpha 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000258013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173465.3-1272s21c1
Sequence:CCGGACACAGTGGTGATCGACTATGCTCGAGCATAGTCGATCACCACTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173465.3-1784s21c1
Sequence:CCGGGAGCCAGGACTAGATGGTTTCCTCGAGGAAACCATCTAGTCCTGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173465.3-688s21c1
Sequence:CCGGGGAAGCTCCATCCGAATGTGTCTCGAGACACATTCGGATGGAGCTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250116    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173465.3-2546s21c1
Sequence:CCGGGGGTCTAGCTCTACCACATTCCTCGAGGAATGTGGTAGAGCTAGACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173465.3-655s21c1
Sequence:CCGGGTTGGACGGACTAGCGAAGATCTCGAGATCTTCGCTAGTCCGTCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173465
COL23A1 MISSION shRNA Lentiviral Transduction Particles
collagen, type XXIII, alpha 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000258013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173465.3-1272s21c1
Sequence:CCGGACACAGTGGTGATCGACTATGCTCGAGCATAGTCGATCACCACTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173465.3-1784s21c1
Sequence:CCGGGAGCCAGGACTAGATGGTTTCCTCGAGGAAACCATCTAGTCCTGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173465.3-688s21c1
Sequence:CCGGGGAAGCTCCATCCGAATGTGTCTCGAGACACATTCGGATGGAGCTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250116    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173465.3-2546s21c1
Sequence:CCGGGGGTCTAGCTCTACCACATTCCTCGAGGAATGTGGTAGAGCTAGACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173465.3-655s21c1
Sequence:CCGGGTTGGACGGACTAGCGAAGATCTCGAGATCTTCGCTAGTCCGTCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks