EMAIL THIS PAGE TO A FRIEND

COL25A1

collagen, type XXV, alpha 1

163 Gene Product Result for
Synonyms: AMY CLAC CLAC-P CLACP
UniProtKB ID: Q9BXS0, A8MPZ6, Q9BXR9
Gene ID:
Human(84570) Summary: This gene encodes a brain-specific membrane associated collagen. A product of proteolytic processing of the encoded protein, CLAC (collagenous Alzheimer amyloid plaque component), binds to amyloid beta-peptides found in Alzheimer amyloid plaques but CLAC inhibits rather than facilitates amyloid fibril elongation (PMID: 16300410). A study of over-expression of this collagen in mice, however, found changes in pathology and behavior suggesting that the encoded protein may promote amyloid plaque formation (PMID: 19548013). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
Mouse(77018) collagen, type XXV, alpha 1
Rat(687064) collagen, type XXV, alpha 1
domestic guinea pig(100717264) collagen, type XXV, alpha 1
naked mole-rat(101706837) collagen, type XXV, alpha 1
sheep(101120576) collagen, type XXV, alpha 1
chicken(429900) collagen, type XXV, alpha 1
dog(610442) collagen, type XXV, alpha 1
Horse(100072894) collagen, type XXV, alpha 1
cow(615661) collagen, type XXV, alpha 1
domestic cat(101089352) collagen, type XXV, alpha 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198711 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198711 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198711 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032518 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032518 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032518 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU157851 MISSION® esiRNA esiRNA human COL25A1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032518 Rosetta Predictions human pricing
NM_198721 Rosetta Predictions human pricing
XM_001076940 Rosetta Predictions rat pricing
NM_029838 Rosetta Predictions mouse pricing
NM_198711 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032518 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00238926 predicted 1684
2 SASI_Hs01_00238927 predicted 854
3 SASI_Hs01_00238928 predicted 1057
4 SASI_Hs01_00238929 predicted 998
5 SASI_Hs01_00238930 predicted 1199
6 SASI_Hs01_00238931 predicted 2019
7 SASI_Hs01_00238932 predicted 1683
8 SASI_Hs01_00238933 predicted 668
9 SASI_Hs01_00238934 predicted 1855
10 SASI_Hs01_00238935 predicted 1835
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198721 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00211588 predicted 1685
2 SASI_Hs01_00211589 predicted 856
3 SASI_Hs01_00211590 predicted 1052
4 SASI_Hs01_00211591 predicted 1005
5 SASI_Hs01_00211592 predicted 1200
6 SASI_Hs01_00211593 predicted 2015
7 SASI_Hs01_00211594 predicted 1689
8 SASI_Hs01_00211595 predicted 677
9 SASI_Hs01_00211596 predicted 1853
10 SASI_Hs01_00211597 predicted 1835
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076940 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00355115 predicted 1313
2 SASI_Rn02_00355116 predicted 521
3 SASI_Rn02_00355117 predicted 1780
4 SASI_Rn02_00355118 predicted 1780
5 SASI_Rn02_00355119 predicted 1188
6 SASI_Rn02_00355120 predicted 1483
7 SASI_Rn02_00355121 predicted 1311
8 SASI_Rn02_00355122 predicted 226
9 SASI_Rn02_00355123 predicted 1145
10 SASI_Rn02_00355124 predicted 1270
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029838 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00059716 predicted 1910
2 SASI_Mm01_00059717 predicted 1919
3 SASI_Mm01_00059718 predicted 786
4 SASI_Mm01_00059719 predicted 2019
5 SASI_Mm01_00059720 predicted 725
6 SASI_Mm01_00059721 predicted 1873
7 SASI_Mm01_00059722 predicted 1908
8 SASI_Mm01_00059723 predicted 1882
9 SASI_Mm02_00336026 predicted 823
10 SASI_Mm01_00059724 predicted 848
11 SASI_Mm01_00059725 predicted 845
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198711 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00351161 predicted 1133
2 SASI_Mm02_00351162 predicted 903
3 SASI_Mm02_00351163 predicted 1548
4 SASI_Mm02_00351164 predicted 1836
5 SASI_Mm02_00351165 predicted 1707
6 SASI_Mm01_00041165 predicted 1836
7 SASI_Mm02_00351166 predicted 1670
8 SASI_Mm02_00351167 predicted 892
9 SASI_Mm01_00041171 predicted 1789
10 SASI_Mm02_00351168 predicted 2764
11 SASI_Mm01_00041164 predicted 1836
12 SASI_Mm01_00041166 predicted 796
13 SASI_Mm01_00041167 predicted 1933
14 SASI_Mm01_00041168 predicted 732
15 SASI_Mm01_00041169 predicted 1801
16 SASI_Mm01_00041170 predicted 1824
17 SASI_Mm01_00041172 predicted 852
18 SASI_Mm01_00041173 predicted 838
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198711
COL25A1 MISSION shRNA Bacterial Glycerol Stock
collagen, type XXV, alpha 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000089713    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198711.2-3051s1c1
Sequence:CCGGCCTGGGTTGATCCATACCAAACTCGAGTTTGGTATGGATCAACCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198711.2-898s1c1
Sequence:CCGGGCTCAGAAATCCTACGAACATCTCGAGATGTTCGTAGGATTTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198711.2-1945s1c1
Sequence:CCGGGATGGAGAACAGGGACTCAAACTCGAGTTTGAGTCCCTGTTCTCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198711.2-1495s1c1
Sequence:CCGGGCAGGAATTAAGGGAGAACCTCTCGAGAGGTTCTCCCTTAATTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198711.2-796s1c1
Sequence:CCGGGCTGCTCTTGAATCTGCTAAACTCGAGTTTAGCAGATTCAAGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198711
COL25A1 MISSION shRNA shRNA Plasmid DNA
collagen, type XXV, alpha 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000089713    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198711.2-3051s1c1
Sequence:CCGGCCTGGGTTGATCCATACCAAACTCGAGTTTGGTATGGATCAACCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198711.2-898s1c1
Sequence:CCGGGCTCAGAAATCCTACGAACATCTCGAGATGTTCGTAGGATTTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198711.2-1945s1c1
Sequence:CCGGGATGGAGAACAGGGACTCAAACTCGAGTTTGAGTCCCTGTTCTCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198711.2-1495s1c1
Sequence:CCGGGCAGGAATTAAGGGAGAACCTCTCGAGAGGTTCTCCCTTAATTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198711.2-796s1c1
Sequence:CCGGGCTGCTCTTGAATCTGCTAAACTCGAGTTTAGCAGATTCAAGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198711
COL25A1 MISSION shRNA Lentiviral Transduction Particles
collagen, type XXV, alpha 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000089713    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198711.2-3051s1c1
Sequence:CCGGCCTGGGTTGATCCATACCAAACTCGAGTTTGGTATGGATCAACCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198711.2-898s1c1
Sequence:CCGGGCTCAGAAATCCTACGAACATCTCGAGATGTTCGTAGGATTTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198711.2-1945s1c1
Sequence:CCGGGATGGAGAACAGGGACTCAAACTCGAGTTTGAGTCCCTGTTCTCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198711.2-1495s1c1
Sequence:CCGGGCAGGAATTAAGGGAGAACCTCTCGAGAGGTTCTCCCTTAATTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198711.2-796s1c1
Sequence:CCGGGCTGCTCTTGAATCTGCTAAACTCGAGTTTAGCAGATTCAAGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032518
COL25A1 MISSION shRNA Bacterial Glycerol Stock
collagen, type XXV, alpha 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000116382    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032518.2-2503s1c1
Sequence:CCGGGCCTGATTTAAGGAATCAGGTCTCGAGACCTGATTCCTTAAATCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032518.2-1456s1c1
Sequence:CCGGGCTGCAGGAATTAAGGGAGAACTCGAGTTCTCCCTTAATTCCTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032518.2-823s1c1
Sequence:CCGGGCTCAGAAATCCTATGAACATCTCGAGATGTTCATAGGATTTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032518.2-1837s1c1
Sequence:CCGGCACGAAGCCTTACAGAGGATTCTCGAGAATCCTCTGTAAGGCTTCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032518.2-783s1c1
Sequence:CCGGCCTCAAGACTATGGTGCAAGACTCGAGTCTTGCACCATAGTCTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032518.2-2447s21c1
Sequence:CCGGGTGATTCCATTTGACACTTAACTCGAGTTAAGTGTCAAATGGAATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032518.2-1060s21c1
Sequence:CCGGGCTGATCAGCAGCTCATTAAACTCGAGTTTAATGAGCTGCTGATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032518.2-2096s21c1
Sequence:CCGGCACAGGGTCCTTCTATCATAGCTCGAGCTATGATAGAAGGACCCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032518.2-1800s21c1
Sequence:CCGGAGGAGCCACTGAGATCATAGACTCGAGTCTATGATCTCAGTGGCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032518
COL25A1 MISSION shRNA shRNA Plasmid DNA
collagen, type XXV, alpha 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000116382    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032518.2-2503s1c1
Sequence:CCGGGCCTGATTTAAGGAATCAGGTCTCGAGACCTGATTCCTTAAATCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032518.2-1456s1c1
Sequence:CCGGGCTGCAGGAATTAAGGGAGAACTCGAGTTCTCCCTTAATTCCTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032518.2-823s1c1
Sequence:CCGGGCTCAGAAATCCTATGAACATCTCGAGATGTTCATAGGATTTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032518.2-1837s1c1
Sequence:CCGGCACGAAGCCTTACAGAGGATTCTCGAGAATCCTCTGTAAGGCTTCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032518.2-783s1c1
Sequence:CCGGCCTCAAGACTATGGTGCAAGACTCGAGTCTTGCACCATAGTCTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032518.2-2447s21c1
Sequence:CCGGGTGATTCCATTTGACACTTAACTCGAGTTAAGTGTCAAATGGAATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032518.2-1060s21c1
Sequence:CCGGGCTGATCAGCAGCTCATTAAACTCGAGTTTAATGAGCTGCTGATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032518.2-2096s21c1
Sequence:CCGGCACAGGGTCCTTCTATCATAGCTCGAGCTATGATAGAAGGACCCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032518.2-1800s21c1
Sequence:CCGGAGGAGCCACTGAGATCATAGACTCGAGTCTATGATCTCAGTGGCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032518
COL25A1 MISSION shRNA Lentiviral Transduction Particles
collagen, type XXV, alpha 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000116382    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032518.2-2503s1c1
Sequence:CCGGGCCTGATTTAAGGAATCAGGTCTCGAGACCTGATTCCTTAAATCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032518.2-1456s1c1
Sequence:CCGGGCTGCAGGAATTAAGGGAGAACTCGAGTTCTCCCTTAATTCCTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032518.2-823s1c1
Sequence:CCGGGCTCAGAAATCCTATGAACATCTCGAGATGTTCATAGGATTTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032518.2-1837s1c1
Sequence:CCGGCACGAAGCCTTACAGAGGATTCTCGAGAATCCTCTGTAAGGCTTCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032518.2-783s1c1
Sequence:CCGGCCTCAAGACTATGGTGCAAGACTCGAGTCTTGCACCATAGTCTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032518.2-2447s21c1
Sequence:CCGGGTGATTCCATTTGACACTTAACTCGAGTTAAGTGTCAAATGGAATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032518.2-1060s21c1
Sequence:CCGGGCTGATCAGCAGCTCATTAAACTCGAGTTTAATGAGCTGCTGATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032518.2-2096s21c1
Sequence:CCGGCACAGGGTCCTTCTATCATAGCTCGAGCTATGATAGAAGGACCCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032518.2-1800s21c1
Sequence:CCGGAGGAGCCACTGAGATCATAGACTCGAGTCTATGATCTCAGTGGCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks