EMAIL THIS PAGE TO A FRIEND

COL26A1

collagen, type XXVI, alpha 1

128 Gene Product Result for
Synonyms: EMI6 EMID2 EMU2 SH2B
UniProtKB ID: Q96A83, Q32M90
Gene ID:
Mouse(140709) collagen, type XXVI, alpha 1
Rat(685612) collagen, type XXVI, alpha 1
naked mole-rat(101698920) collagen, type XXVI, alpha 1
domestic guinea pig(100732108) collagen, type XXVI, alpha 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV52562 Anti-EMID2 (AB1) antibody produced in rabbit affinity isolated antibody guinea pig, human, rat, rabbit, horse, mouse, bovine
western blot pricing
AV52563 Anti-EMID2 (AB2) antibody produced in rabbit affinity isolated antibody bovine, human, horse, rabbit, rat, mouse
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133457 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_133457 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_133457 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_024474 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024474 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024474 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU160601 MISSION® esiRNA esiRNA human EMID2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_133457 Rosetta Predictions human pricing
XM_001064529 Rosetta Predictions rat pricing
NM_024474 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133457 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00198866 predicted 627
2 SASI_Hs02_00363144 predicted 1393
3 SASI_Hs01_00198868 predicted 552
4 SASI_Hs01_00198870 predicted 1062
5 SASI_Hs02_00363145 predicted 455
6 SASI_Hs02_00363146 predicted 462
7 SASI_Hs02_00363147 predicted 282
8 SASI_Hs01_00198872 predicted 596
9 SASI_Hs01_00198873 predicted 548
10 SASI_Hs01_00198874 predicted 585
11 SASI_Hs01_00198867 predicted 276
12 SASI_Hs01_00198869 predicted 288
13 SASI_Hs01_00198871 predicted 363
14 SASI_Hs01_00198875 predicted 376
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001064529 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00310879 predicted 1570
2 SASI_Rn02_00310880 predicted 322
3 SASI_Rn02_00310881 predicted 1407
4 SASI_Rn02_00310882 predicted 350
5 SASI_Rn02_00310883 predicted 1169
6 SASI_Rn02_00310884 predicted 279
7 SASI_Rn02_00310885 predicted 1578
8 SASI_Rn02_00310886 predicted 231
9 SASI_Rn02_00310887 predicted 1348
10 SASI_Rn02_00310888 predicted 363
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024474 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00042425 predicted 499
2 SASI_Mm01_00042426 predicted 1819
3 SASI_Mm01_00042427 predicted 1751
4 SASI_Mm01_00042428 predicted 1497
5 SASI_Mm01_00042429 predicted 1764
6 SASI_Mm01_00042430 predicted 361
7 SASI_Mm01_00042431 predicted 376
8 SASI_Mm01_00042432 predicted 419
9 SASI_Mm01_00042434 predicted 1896
10 SASI_Mm02_00327858 predicted 394
11 SASI_Mm01_00042433 predicted 1423
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133457
COL26A1 MISSION shRNA Bacterial Glycerol Stock
collagen, type XXVI, alpha 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133457.2-597s21c1
Sequence:CCGGTGACATGAGTGAGCGACTGACCTCGAGGTCAGTCGCTCACTCATGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431802    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133457.2-1847s21c1
Sequence:CCGGTCGTTACGTTGTCTCATTATTCTCGAGAATAATGAGACAACGTAACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133457.2-1334s21c1
Sequence:CCGGACATGATTGGGATCCACGATCCTCGAGGATCGTGGATCCCAATCATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422079    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133457.2-1787s21c1
Sequence:CCGGTAATCCTAATACCCATCATTTCTCGAGAAATGATGGGTATTAGGATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133457.1-838s1c1
Sequence:CCGGCCGCCTACAGACAAAGACAATCTCGAGATTGTCTTTGTCTGTAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133457.1-837s1c1
Sequence:CCGGGCCGCCTACAGACAAAGACAACTCGAGTTGTCTTTGTCTGTAGGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133457.1-371s1c1
Sequence:CCGGGCAACTGTGATGAGGAATGCACTCGAGTGCATTCCTCATCACAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133457.1-519s1c1
Sequence:CCGGGCCGACCTGGAATGAGGACTTCTCGAGAAGTCCTCATTCCAGGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133457.1-276s1c1
Sequence:CCGGCGTAAGTTACAGGACTCTGATCTCGAGATCAGAGTCCTGTAACTTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133457
COL26A1 MISSION shRNA shRNA Plasmid DNA
collagen, type XXVI, alpha 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133457.2-597s21c1
Sequence:CCGGTGACATGAGTGAGCGACTGACCTCGAGGTCAGTCGCTCACTCATGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431802    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133457.2-1847s21c1
Sequence:CCGGTCGTTACGTTGTCTCATTATTCTCGAGAATAATGAGACAACGTAACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133457.2-1334s21c1
Sequence:CCGGACATGATTGGGATCCACGATCCTCGAGGATCGTGGATCCCAATCATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422079    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133457.2-1787s21c1
Sequence:CCGGTAATCCTAATACCCATCATTTCTCGAGAAATGATGGGTATTAGGATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133457.1-838s1c1
Sequence:CCGGCCGCCTACAGACAAAGACAATCTCGAGATTGTCTTTGTCTGTAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133457.1-837s1c1
Sequence:CCGGGCCGCCTACAGACAAAGACAACTCGAGTTGTCTTTGTCTGTAGGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133457.1-371s1c1
Sequence:CCGGGCAACTGTGATGAGGAATGCACTCGAGTGCATTCCTCATCACAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133457.1-519s1c1
Sequence:CCGGGCCGACCTGGAATGAGGACTTCTCGAGAAGTCCTCATTCCAGGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133457.1-276s1c1
Sequence:CCGGCGTAAGTTACAGGACTCTGATCTCGAGATCAGAGTCCTGTAACTTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133457
COL26A1 MISSION shRNA Lentiviral Transduction Particles
collagen, type XXVI, alpha 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133457.2-597s21c1
Sequence:CCGGTGACATGAGTGAGCGACTGACCTCGAGGTCAGTCGCTCACTCATGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431802    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133457.2-1847s21c1
Sequence:CCGGTCGTTACGTTGTCTCATTATTCTCGAGAATAATGAGACAACGTAACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133457.2-1334s21c1
Sequence:CCGGACATGATTGGGATCCACGATCCTCGAGGATCGTGGATCCCAATCATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422079    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133457.2-1787s21c1
Sequence:CCGGTAATCCTAATACCCATCATTTCTCGAGAAATGATGGGTATTAGGATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133457.1-838s1c1
Sequence:CCGGCCGCCTACAGACAAAGACAATCTCGAGATTGTCTTTGTCTGTAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133457.1-837s1c1
Sequence:CCGGGCCGCCTACAGACAAAGACAACTCGAGTTGTCTTTGTCTGTAGGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133457.1-371s1c1
Sequence:CCGGGCAACTGTGATGAGGAATGCACTCGAGTGCATTCCTCATCACAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133457.1-519s1c1
Sequence:CCGGGCCGACCTGGAATGAGGACTTCTCGAGAAGTCCTCATTCCAGGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133457.1-276s1c1
Sequence:CCGGCGTAAGTTACAGGACTCTGATCTCGAGATCAGAGTCCTGTAACTTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024474
COL26A1 MISSION shRNA Bacterial Glycerol Stock
collagen, type XXVI, alpha 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024474.2-365s21c1
Sequence:CCGGTGTGCCAACCTCGTGAGTTACCTCGAGGTAACTCACGAGGTTGGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248459    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024474.2-2468s21c1
Sequence:CCGGCCATCCTGGTGCTCCTATAACCTCGAGGTTATAGGAGCACCAGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024474.2-490s21c1
Sequence:CCGGTATGAACTGTACCCGGCTTAGCTCGAGCTAAGCCGGGTACAGTTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024474.2-396s21c1
Sequence:CCGGTTAGACCGACCTACCGGGTTTCTCGAGAAACCCGGTAGGTCGGTCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024474.2-1228s21c1
Sequence:CCGGGGTCCTTATCCTTGAGCATATCTCGAGATATGCTCAAGGATAAGGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024474
COL26A1 MISSION shRNA shRNA Plasmid DNA
collagen, type XXVI, alpha 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024474.2-365s21c1
Sequence:CCGGTGTGCCAACCTCGTGAGTTACCTCGAGGTAACTCACGAGGTTGGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248459    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024474.2-2468s21c1
Sequence:CCGGCCATCCTGGTGCTCCTATAACCTCGAGGTTATAGGAGCACCAGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024474.2-490s21c1
Sequence:CCGGTATGAACTGTACCCGGCTTAGCTCGAGCTAAGCCGGGTACAGTTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024474.2-396s21c1
Sequence:CCGGTTAGACCGACCTACCGGGTTTCTCGAGAAACCCGGTAGGTCGGTCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024474.2-1228s21c1
Sequence:CCGGGGTCCTTATCCTTGAGCATATCTCGAGATATGCTCAAGGATAAGGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024474
COL26A1 MISSION shRNA Lentiviral Transduction Particles
collagen, type XXVI, alpha 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024474.2-365s21c1
Sequence:CCGGTGTGCCAACCTCGTGAGTTACCTCGAGGTAACTCACGAGGTTGGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248459    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024474.2-2468s21c1
Sequence:CCGGCCATCCTGGTGCTCCTATAACCTCGAGGTTATAGGAGCACCAGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024474.2-490s21c1
Sequence:CCGGTATGAACTGTACCCGGCTTAGCTCGAGCTAAGCCGGGTACAGTTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024474.2-396s21c1
Sequence:CCGGTTAGACCGACCTACCGGGTTTCTCGAGAAACCCGGTAGGTCGGTCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024474.2-1228s21c1
Sequence:CCGGGGTCCTTATCCTTGAGCATATCTCGAGATATGCTCAAGGATAAGGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks