EMAIL THIS PAGE TO A FRIEND

COL27A1

collagen, type XXVII, alpha 1

UniProtKB ID: Q8IZC6, Q66K43, Q96JF7
Gene ID:
Human(85301) Summary: Fibrillar collagens, such as COL27A1, compose one of the most ancient families of extracellular matrix molecules. They form major structural elements in extracellular matrices of cartilage, skin, and tendon (Boot-Handford et al., 2003 [PubMed 12766169]
Mouse(373864) collagen, type XXVII, alpha 1
Rat(298101) collagen, type XXVII, alpha 1
domestic guinea pig(100726517) collagen, type XXVII, alpha 1
naked mole-rat(101725027) collagen, type XXVII, alpha 1
sheep(101119374) collagen, type XXVII, alpha 1
chicken(417231) collagen, type XXVII, alpha 1
cow(513668) collagen, type XXVII, alpha 1
Horse(100051633) collagen, type XXVII, alpha 1
domestic cat(101098263) collagen, type XXVII, alpha 1
dog(474811) collagen, type XXVII, alpha 1
136 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032888 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032888 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032888 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025685 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025685 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025685 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU157161 MISSION® esiRNA esiRNA human COL27A1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032888 Rosetta Predictions human pricing
NM_198747 Rosetta Predictions rat pricing
NM_025685 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032888 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00085846 predicted 5087
2 SASI_Hs01_00085847 predicted 5252
3 SASI_Hs01_00085848 predicted 4641
4 SASI_Hs01_00085849 predicted 2976
5 SASI_Hs01_00085850 predicted 914
6 SASI_Hs01_00085851 predicted 2680
7 SASI_Hs01_00085852 predicted 1121
8 SASI_Hs01_00085853 predicted 5156
9 SASI_Hs01_00085854 predicted 2454
10 SASI_Hs01_00085855 predicted 3410
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198747 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00269969 predicted 5067
2 SASI_Rn01_00102096 predicted 1822
3 SASI_Rn01_00102097 predicted 4623
4 SASI_Rn01_00102098 predicted 5133
5 SASI_Rn01_00102099 predicted 3896
6 SASI_Rn01_00102100 predicted 2962
7 SASI_Rn01_00102102 predicted 1338
8 SASI_Rn02_00269970 predicted 2459
9 SASI_Rn01_00102103 predicted 3889
10 SASI_Rn01_00102104 predicted 454
11 SASI_Rn01_00102095 predicted 853
12 SASI_Rn01_00102101 predicted 5213
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025685 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00167226 predicted 5517
2 SASI_Mm01_00167227 predicted 5648
3 SASI_Mm01_00167228 predicted 1375
4 SASI_Mm01_00167229 predicted 3051
5 SASI_Mm01_00167230 predicted 5014
6 SASI_Mm01_00167231 predicted 4291
7 SASI_Mm02_00328832 predicted 5760
8 SASI_Mm01_00167232 predicted 910
9 SASI_Mm01_00167234 predicted 4278
10 SASI_Mm01_00167235 predicted 1423
11 SASI_Mm01_00167233 predicted 4821
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032888
VALIDATED
COL27A1 MISSION shRNA Bacterial Glycerol Stock
collagen, type XXVII, alpha 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000116603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032888.2-2977s1c1
Sequence:CCGGCAGGGATTTATGGGATTCATTCTCGAGAATGAATCCCATAAATCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032888.2-4861s1c1
Sequence:CCGGCCTATCCAATTGCAACAAGATCTCGAGATCTTGTTGCAATTGGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032888.2-1056s1c1
Sequence:CCGGCGCTCAACCATCACAGAAGATCTCGAGATCTTCTGTGATGGTTGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_032888.2-642s1c1
Sequence:CCGGCCAGTTCAGTATCTACCCTGTCTCGAGACAGGGTAGATACTGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000443451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032888.2-2474s21c1
Sequence:CCGGTAGGAGTGTTGGGTCCGATTGCTCGAGCAATCGGACCCAACACTCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032888.2-5230s21c1
Sequence:CCGGATCAGCCGGGTCCAGATGAATCTCGAGATTCATCTGGACCCGGCTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032888.2-610s21c1
Sequence:CCGGCCGCATGCAGTCCAGTTTGAACTCGAGTTCAAACTGGACTGCATGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032888.2-1390s21c1
Sequence:CCGGATAACCAGCCATGCCAGTAAGCTCGAGCTTACTGGCATGGCTGGTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032888
VALIDATED
COL27A1 MISSION shRNA shRNA Plasmid DNA
collagen, type XXVII, alpha 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000116603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032888.2-2977s1c1
Sequence:CCGGCAGGGATTTATGGGATTCATTCTCGAGAATGAATCCCATAAATCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032888.2-4861s1c1
Sequence:CCGGCCTATCCAATTGCAACAAGATCTCGAGATCTTGTTGCAATTGGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032888.2-1056s1c1
Sequence:CCGGCGCTCAACCATCACAGAAGATCTCGAGATCTTCTGTGATGGTTGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_032888.2-642s1c1
Sequence:CCGGCCAGTTCAGTATCTACCCTGTCTCGAGACAGGGTAGATACTGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000443451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032888.2-2474s21c1
Sequence:CCGGTAGGAGTGTTGGGTCCGATTGCTCGAGCAATCGGACCCAACACTCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032888.2-5230s21c1
Sequence:CCGGATCAGCCGGGTCCAGATGAATCTCGAGATTCATCTGGACCCGGCTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032888.2-610s21c1
Sequence:CCGGCCGCATGCAGTCCAGTTTGAACTCGAGTTCAAACTGGACTGCATGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032888.2-1390s21c1
Sequence:CCGGATAACCAGCCATGCCAGTAAGCTCGAGCTTACTGGCATGGCTGGTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032888
VALIDATED
COL27A1 MISSION shRNA Lentiviral Transduction Particles
collagen, type XXVII, alpha 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000116603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032888.2-2977s1c1
Sequence:CCGGCAGGGATTTATGGGATTCATTCTCGAGAATGAATCCCATAAATCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032888.2-4861s1c1
Sequence:CCGGCCTATCCAATTGCAACAAGATCTCGAGATCTTGTTGCAATTGGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032888.2-1056s1c1
Sequence:CCGGCGCTCAACCATCACAGAAGATCTCGAGATCTTCTGTGATGGTTGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_032888.2-642s1c1
Sequence:CCGGCCAGTTCAGTATCTACCCTGTCTCGAGACAGGGTAGATACTGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000443451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032888.2-2474s21c1
Sequence:CCGGTAGGAGTGTTGGGTCCGATTGCTCGAGCAATCGGACCCAACACTCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032888.2-5230s21c1
Sequence:CCGGATCAGCCGGGTCCAGATGAATCTCGAGATTCATCTGGACCCGGCTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032888.2-610s21c1
Sequence:CCGGCCGCATGCAGTCCAGTTTGAACTCGAGTTCAAACTGGACTGCATGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032888.2-1390s21c1
Sequence:CCGGATAACCAGCCATGCCAGTAAGCTCGAGCTTACTGGCATGGCTGGTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025685
COL27A1 MISSION shRNA Bacterial Glycerol Stock
collagen, type XXVII, alpha 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000091723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025685.2-3877s1c1
Sequence:CCGGGCCGGTTATAATGGACACAAACTCGAGTTTGTGTCCATTATAACCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025685.2-312s1c1
Sequence:CCGGCCTCTGTTCACATCGTGTGAACTCGAGTTCACACGATGTGAACAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025685.2-1320s1c1
Sequence:CCGGCCCTACTACTGGCTTATCTAACTCGAGTTAGATAAGCCAGTAGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025685.2-1319s1c1
Sequence:CCGGGCCCTACTACTGGCTTATCTACTCGAGTAGATAAGCCAGTAGTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025685.2-4974s1c1
Sequence:CCGGCCAGAGCATTAAGACACCCTTCTCGAGAAGGGTGTCTTAATGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025685
COL27A1 MISSION shRNA shRNA Plasmid DNA
collagen, type XXVII, alpha 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000091723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025685.2-3877s1c1
Sequence:CCGGGCCGGTTATAATGGACACAAACTCGAGTTTGTGTCCATTATAACCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025685.2-312s1c1
Sequence:CCGGCCTCTGTTCACATCGTGTGAACTCGAGTTCACACGATGTGAACAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025685.2-1320s1c1
Sequence:CCGGCCCTACTACTGGCTTATCTAACTCGAGTTAGATAAGCCAGTAGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025685.2-1319s1c1
Sequence:CCGGGCCCTACTACTGGCTTATCTACTCGAGTAGATAAGCCAGTAGTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025685.2-4974s1c1
Sequence:CCGGCCAGAGCATTAAGACACCCTTCTCGAGAAGGGTGTCTTAATGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025685
COL27A1 MISSION shRNA Lentiviral Transduction Particles
collagen, type XXVII, alpha 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000091723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025685.2-3877s1c1
Sequence:CCGGGCCGGTTATAATGGACACAAACTCGAGTTTGTGTCCATTATAACCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025685.2-312s1c1
Sequence:CCGGCCTCTGTTCACATCGTGTGAACTCGAGTTCACACGATGTGAACAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025685.2-1320s1c1
Sequence:CCGGCCCTACTACTGGCTTATCTAACTCGAGTTAGATAAGCCAGTAGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025685.2-1319s1c1
Sequence:CCGGGCCCTACTACTGGCTTATCTACTCGAGTAGATAAGCCAGTAGTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025685.2-4974s1c1
Sequence:CCGGCCAGAGCATTAAGACACCCTTCTCGAGAAGGGTGTCTTAATGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks