EMAIL THIS PAGE TO A FRIEND

COL28A1

collagen, type XXVIII, alpha 1

56 Gene Product Result for
Synonyms: COL28
Gene ID:
Human(340267) Summary: COL28A1 belongs to a class of collagens containing von Willebrand factor (VWF; MIM 613160) type A (VWFA) domains (Veit et al., 2006 [PubMed 16330543]
Mouse(213945) collagen, type XXVIII, alpha 1
Zebrafish(555428) collagen, type XXVIII, alpha 1
chicken(420576) collagen, type XXVIII, alpha 1
dog(482315) collagen, type XXVIII, alpha 1
Horse(100063901) collagen, type XXVIII, alpha 1
cow(525725) collagen, type XXVIII, alpha 1
cow(100847952) collagen, type XXVIII, alpha 1
domestic cat(101096712) collagen, type XXVIII, alpha 1
sheep(101115616) collagen, type XXVIII, alpha 1
Domestic Rabbit(100350085) collagen, type XXVIII, alpha 1
naked mole-rat(101705361) collagen, type XXVIII, alpha 1
domestic guinea pig(100714508) collagen, type XXVIII, alpha 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001037763 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001037763 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001037763 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_145161 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_145161 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_145161 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU165821 MISSION® esiRNA esiRNA targeting mouse Col28a1 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001037763 Rosetta Predictions human pricing
NM_001037865 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037763 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00071733 predicted 461
2 SASI_Hs01_00071734 predicted 756
3 SASI_Hs02_00308367 predicted 676
4 SASI_Hs01_00071736 predicted 739
5 SASI_Hs01_00071737 predicted 2225
6 SASI_Hs01_00071738 predicted 2930
7 SASI_Hs01_00071739 predicted 2544
8 SASI_Hs02_00308368 predicted 2395
9 SASI_Hs01_00071740 predicted 1381
10 SASI_Hs01_00071741 predicted 236
11 SASI_Hs01_00071735 predicted 677
12 SASI_Hs01_00071742 predicted 2629
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037865 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00043581 predicted 3562
2 SASI_Mm01_00043582 predicted 2745
3 SASI_Mm01_00043583 predicted 1395
4 SASI_Mm01_00043584 predicted 2887
5 SASI_Mm01_00043586 predicted 1465
6 SASI_Mm02_00289479 predicted 3458
7 SASI_Mm01_00043587 predicted 1893
8 SASI_Mm01_00043588 predicted 3075
9 SASI_Mm01_00043589 predicted 362
10 SASI_Mm01_00043590 predicted 472
11 SASI_Mm01_00043585 predicted 3540
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001037763
COL28A1 MISSION shRNA Bacterial Glycerol Stock
collagen, type XXVIII, alpha 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037763.2-815s21c1
Sequence:CCGGAGAAGTGTGAACGCAAGATTTCTCGAGAAATCTTGCGTTCACACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037763.2-531s21c1
Sequence:CCGGCAATGCCACTAGGCTACTTAACTCGAGTTAAGTAGCCTAGTGGCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037763.2-3069s21c1
Sequence:CCGGTGATTCCTATCTCGTTCAAATCTCGAGATTTGAACGAGATAGGAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037763.2-2624s21c1
Sequence:CCGGGCATAGGCATAATCAACTATACTCGAGTATAGTTGATTATGCCTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037763.2-1190s21c1
Sequence:CCGGGAATTGGACAGCAAGGTATTACTCGAGTAATACCTTGCTGTCCAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001037763
COL28A1 MISSION shRNA shRNA Plasmid DNA
collagen, type XXVIII, alpha 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037763.2-815s21c1
Sequence:CCGGAGAAGTGTGAACGCAAGATTTCTCGAGAAATCTTGCGTTCACACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037763.2-531s21c1
Sequence:CCGGCAATGCCACTAGGCTACTTAACTCGAGTTAAGTAGCCTAGTGGCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037763.2-3069s21c1
Sequence:CCGGTGATTCCTATCTCGTTCAAATCTCGAGATTTGAACGAGATAGGAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037763.2-2624s21c1
Sequence:CCGGGCATAGGCATAATCAACTATACTCGAGTATAGTTGATTATGCCTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037763.2-1190s21c1
Sequence:CCGGGAATTGGACAGCAAGGTATTACTCGAGTAATACCTTGCTGTCCAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001037763
COL28A1 MISSION shRNA Lentiviral Transduction Particles
collagen, type XXVIII, alpha 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037763.2-815s21c1
Sequence:CCGGAGAAGTGTGAACGCAAGATTTCTCGAGAAATCTTGCGTTCACACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037763.2-531s21c1
Sequence:CCGGCAATGCCACTAGGCTACTTAACTCGAGTTAAGTAGCCTAGTGGCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037763.2-3069s21c1
Sequence:CCGGTGATTCCTATCTCGTTCAAATCTCGAGATTTGAACGAGATAGGAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037763.2-2624s21c1
Sequence:CCGGGCATAGGCATAATCAACTATACTCGAGTATAGTTGATTATGCCTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037763.2-1190s21c1
Sequence:CCGGGAATTGGACAGCAAGGTATTACTCGAGTAATACCTTGCTGTCCAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_145161
COL28A1 MISSION shRNA Bacterial Glycerol Stock
collagen, type XXVIII, alpha 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000091574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_145161.4-2201s1c1
Sequence:CCGGGCTATGGATCACAAGGAATTACTCGAGTAATTCCTTGTGATCCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_145161.4-829s1c1
Sequence:CCGGCCTTCCAATGAACCCGTTCTACTCGAGTAGAACGGGTTCATTGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_145161.4-570s1c1
Sequence:CCGGGCGGGTCAAGTCTCTGAATTTCTCGAGAAATTCAGAGACTTGACCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_145161.4-2698s1c1
Sequence:CCGGGCAGCTAATGACATGTTCAAACTCGAGTTTGAACATGTCATTAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_145161.4-3266s1c1
Sequence:CCGGCCCATTTGTTACAGTCAGAAACTCGAGTTTCTGACTGTAACAAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_145161
COL28A1 MISSION shRNA shRNA Plasmid DNA
collagen, type XXVIII, alpha 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000091574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_145161.4-2201s1c1
Sequence:CCGGGCTATGGATCACAAGGAATTACTCGAGTAATTCCTTGTGATCCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_145161.4-829s1c1
Sequence:CCGGCCTTCCAATGAACCCGTTCTACTCGAGTAGAACGGGTTCATTGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_145161.4-570s1c1
Sequence:CCGGGCGGGTCAAGTCTCTGAATTTCTCGAGAAATTCAGAGACTTGACCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_145161.4-2698s1c1
Sequence:CCGGGCAGCTAATGACATGTTCAAACTCGAGTTTGAACATGTCATTAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_145161.4-3266s1c1
Sequence:CCGGCCCATTTGTTACAGTCAGAAACTCGAGTTTCTGACTGTAACAAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_145161
COL28A1 MISSION shRNA Lentiviral Transduction Particles
collagen, type XXVIII, alpha 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000091574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_145161.4-2201s1c1
Sequence:CCGGGCTATGGATCACAAGGAATTACTCGAGTAATTCCTTGTGATCCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_145161.4-829s1c1
Sequence:CCGGCCTTCCAATGAACCCGTTCTACTCGAGTAGAACGGGTTCATTGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_145161.4-570s1c1
Sequence:CCGGGCGGGTCAAGTCTCTGAATTTCTCGAGAAATTCAGAGACTTGACCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_145161.4-2698s1c1
Sequence:CCGGGCAGCTAATGACATGTTCAAACTCGAGTTTGAACATGTCATTAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_145161.4-3266s1c1
Sequence:CCGGCCCATTTGTTACAGTCAGAAACTCGAGTTTCTGACTGTAACAAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks