EMAIL THIS PAGE TO A FRIEND

COL2A1

collagen, type II, alpha 1

135 Gene Product Result for
Synonyms: ANFH AOM COL11A3 SEDC
Gene ID:
Human(1280) Summary: This gene encodes the alpha-1 chain of type II collagen, a fibrillar collagen found in cartilage and the vitreous humor of the eye. Mutations in this gene are associated with achondrogenesis, chondrodysplasia, early onset familial osteoarthritis, SED congenita, Langer-Saldino achondrogenesis, Kniest dysplasia, Stickler syndrome type I, and spondyloepimetaphyseal dysplasia Strudwick type. In addition, defects in processing chondrocalcin, a calcium binding protein that is the C-propeptide of this collagen molecule, are also associated with chondrodysplasia. There are two transcripts identified for this gene. [provided by RefSeq, Jul 2008]
Mouse(12824) collagen, type II, alpha 1
Rat(25412) collagen, type II, alpha 1
chicken(395069) collagen, type II, alpha 1
dog(403826) collagen, type II, alpha 1
cow(407142) collagen, type II, alpha 1
Horse(791241) collagen, type II, alpha 1
domestic cat(101087493) collagen, type II, alpha 1
domestic guinea pig(100733907) collagen, type II, alpha 1
naked mole-rat(101707672) collagen, type II, alpha 1
Goat(100860743) collagen, type II, alpha 1
Domestic Rabbit(100009005) collagen, type II, alpha 1
sheep(100196905) collagen, type II, alpha 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031163 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_031163 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_031163 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001844 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001844 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001844 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU073171 MISSION® esiRNA esiRNA targeting mouse Col2a1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001844 Rosetta Predictions human pricing
NM_033150 Rosetta Predictions human pricing
NM_012929 Rosetta Predictions rat pricing
NM_001113515 Rosetta Predictions mouse pricing
NM_031163 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001844 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00332655 predicted 4160
2 SASI_Hs01_00164236 predicted 4604
3 SASI_Hs01_00164237 predicted 3947
4 SASI_Hs01_00164239 predicted 4263
5 SASI_Hs02_00332656 predicted 2571
6 SASI_Hs01_00164241 predicted 4226
7 SASI_Hs02_00332657 predicted 4595
8 SASI_Hs01_00164242 predicted 4724
9 SASI_Hs02_00332658 predicted 4453
10 SASI_Hs01_00164243 predicted 4564
11 SASI_Hs01_00164238 predicted 4428
12 SASI_Hs01_00164240 predicted 4674
13 SASI_Hs01_00164244 predicted 1416
14 SASI_Hs01_00164245 predicted 3952
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033150 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00360886 predicted 3954
2 SASI_Hs01_00114242 predicted 4393
3 SASI_Hs01_00114243 predicted 3738
4 SASI_Hs01_00114245 predicted 4055
5 SASI_Hs02_00360887 predicted 2369
6 SASI_Hs01_00114247 predicted 4027
7 SASI_Hs02_00360888 predicted 4395
8 SASI_Hs01_00114248 predicted 4520
9 SASI_Hs02_00360889 predicted 4239
10 SASI_Hs01_00114249 predicted 4360
11 SASI_Hs01_00114244 predicted 4229
12 SASI_Hs01_00114246 predicted 4465
13 SASI_Hs01_00114250 predicted 1202
14 SASI_Hs01_00114251 predicted 3741
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012929 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00071579 predicted 4297
2 SASI_Rn01_00071580 predicted 3451
3 SASI_Rn01_00071581 predicted 4205
4 SASI_Rn02_00260474 predicted 1817
5 SASI_Rn01_00071582 predicted 3660
6 SASI_Rn01_00071584 predicted 4234
7 SASI_Rn01_00071585 predicted 1473
8 SASI_Rn01_00071586 predicted 1765
9 SASI_Rn01_00071587 predicted 3750
10 SASI_Rn02_00260475 predicted 1167
11 SASI_Rn01_00071578 predicted 2238
12 SASI_Rn01_00071583 predicted 3869
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113515 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00308033 predicted 4533
2 SASI_Mm02_00308034 predicted 4565
3 SASI_Mm02_00308035 predicted 3799
4 SASI_Mm02_00308036 predicted 1254
5 SASI_Mm02_00308037 predicted 1489
6 SASI_Mm02_00308038 predicted 4509
7 SASI_Mm02_00308039 predicted 1401
8 SASI_Mm02_00308040 predicted 4074
9 SASI_Mm02_00308041 predicted 1743
10 SASI_Mm02_00308042 predicted 4543
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031163 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00149841 predicted 4738
2 SASI_Mm02_00336980 predicted 4770
3 SASI_Mm01_00149845 predicted 4010
4 SASI_Mm02_00336981 predicted 1460
5 SASI_Mm01_00149846 predicted 1695
6 SASI_Mm02_00336982 predicted 4712
7 SASI_Mm02_00336983 predicted 1600
8 SASI_Mm01_00149849 predicted 4276
9 SASI_Mm02_00336984 predicted 1940
10 SASI_Mm02_00336985 predicted 4743
11 SASI_Mm01_00149842 predicted 3539
12 SASI_Mm01_00149843 predicted 256
13 SASI_Mm01_00149844 predicted 272
14 SASI_Mm01_00149847 predicted 332
15 SASI_Mm01_00149848 predicted 4135
16 SASI_Mm01_00149850 predicted 285
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031163
COL2A1 MISSION shRNA Bacterial Glycerol Stock
collagen, type II, alpha 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000090777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031163.2-266s1c1
Sequence:CCGGGCAGAGGTATAAAGATAAGGACTCGAGTCCTTATCTTTATACCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090773    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031163.2-5136s1c1
Sequence:CCGGGCGACCAGAAATCAAACAGTACTCGAGTACTGTTTGATTTCTGGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031163.2-2190s1c1
Sequence:CCGGCCTGGTACTGATGGTCCCAAACTCGAGTTTGGGACCATCAGTACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031163.2-4328s1c1
Sequence:CCGGCTGCACGAAACACACTGGTAACTCGAGTTACCAGTGTGTTTCGTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031163.2-3785s1c1
Sequence:CCGGCGCTACACTCAAGTCACTGAACTCGAGTTCAGTGACTTGAGTGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031163
COL2A1 MISSION shRNA shRNA Plasmid DNA
collagen, type II, alpha 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000090777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031163.2-266s1c1
Sequence:CCGGGCAGAGGTATAAAGATAAGGACTCGAGTCCTTATCTTTATACCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090773    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031163.2-5136s1c1
Sequence:CCGGGCGACCAGAAATCAAACAGTACTCGAGTACTGTTTGATTTCTGGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031163.2-2190s1c1
Sequence:CCGGCCTGGTACTGATGGTCCCAAACTCGAGTTTGGGACCATCAGTACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031163.2-4328s1c1
Sequence:CCGGCTGCACGAAACACACTGGTAACTCGAGTTACCAGTGTGTTTCGTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031163.2-3785s1c1
Sequence:CCGGCGCTACACTCAAGTCACTGAACTCGAGTTCAGTGACTTGAGTGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031163
COL2A1 MISSION shRNA Lentiviral Transduction Particles
collagen, type II, alpha 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000090777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031163.2-266s1c1
Sequence:CCGGGCAGAGGTATAAAGATAAGGACTCGAGTCCTTATCTTTATACCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090773    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031163.2-5136s1c1
Sequence:CCGGGCGACCAGAAATCAAACAGTACTCGAGTACTGTTTGATTTCTGGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031163.2-2190s1c1
Sequence:CCGGCCTGGTACTGATGGTCCCAAACTCGAGTTTGGGACCATCAGTACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031163.2-4328s1c1
Sequence:CCGGCTGCACGAAACACACTGGTAACTCGAGTTACCAGTGTGTTTCGTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031163.2-3785s1c1
Sequence:CCGGCGCTACACTCAAGTCACTGAACTCGAGTTCAGTGACTTGAGTGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001844
COL2A1 MISSION shRNA Bacterial Glycerol Stock
collagen, type II, alpha 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000083623    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001844.3-4719s1c1
Sequence:CCGGCCTGACCTGATGTCCATTCATCTCGAGATGAATGGACATCAGGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001844.3-1538s1c1
Sequence:CCGGGCTGGCTTCAAAGGTGAACAACTCGAGTTGTTCACCTTTGAAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001844.3-3928s1c1
Sequence:CCGGCACACTCAAGTCCCTCAACAACTCGAGTTGTTGAGGGACTTGAGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001844.3-272s1c1
Sequence:CCGGCAGAGGTATAATGATAAGGATCTCGAGATCCTTATCATTATACCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001844.3-815s1c1
Sequence:CCGGCCTCAAGGATTTCAAGGCAATCTCGAGATTGCCTTGAAATCCTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001844.4-2814s21c1
Sequence:CCGGCTGGAGTGACTGGTCCTAAAGCTCGAGCTTTAGGACCAGTCACTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291580    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001844.4-4743s21c1
Sequence:CCGGCCTGACCTGATGTCCATTCATCTCGAGATGAATGGACATCAGGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001844.4-363s21c1
Sequence:CCGGCTGTCCTCTGCGACGACATAACTCGAGTTATGTCGTCGCAGAGGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001844.4-4626s21c1
Sequence:CCGGGGCCGGTCTGCTTCTTGTAAACTCGAGTTTACAAGAAGCAGACCGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001844.4-1562s21c1
Sequence:CCGGGCTGGCTTCAAAGGTGAACAACTCGAGTTGTTCACCTTTGAAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001844
COL2A1 MISSION shRNA shRNA Plasmid DNA
collagen, type II, alpha 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000083623    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001844.3-4719s1c1
Sequence:CCGGCCTGACCTGATGTCCATTCATCTCGAGATGAATGGACATCAGGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001844.3-1538s1c1
Sequence:CCGGGCTGGCTTCAAAGGTGAACAACTCGAGTTGTTCACCTTTGAAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001844.3-3928s1c1
Sequence:CCGGCACACTCAAGTCCCTCAACAACTCGAGTTGTTGAGGGACTTGAGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001844.3-272s1c1
Sequence:CCGGCAGAGGTATAATGATAAGGATCTCGAGATCCTTATCATTATACCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001844.3-815s1c1
Sequence:CCGGCCTCAAGGATTTCAAGGCAATCTCGAGATTGCCTTGAAATCCTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001844.4-2814s21c1
Sequence:CCGGCTGGAGTGACTGGTCCTAAAGCTCGAGCTTTAGGACCAGTCACTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291580    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001844.4-4743s21c1
Sequence:CCGGCCTGACCTGATGTCCATTCATCTCGAGATGAATGGACATCAGGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001844.4-363s21c1
Sequence:CCGGCTGTCCTCTGCGACGACATAACTCGAGTTATGTCGTCGCAGAGGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001844.4-4626s21c1
Sequence:CCGGGGCCGGTCTGCTTCTTGTAAACTCGAGTTTACAAGAAGCAGACCGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001844.4-1562s21c1
Sequence:CCGGGCTGGCTTCAAAGGTGAACAACTCGAGTTGTTCACCTTTGAAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001844
COL2A1 MISSION shRNA Lentiviral Transduction Particles
collagen, type II, alpha 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000083623    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001844.3-4719s1c1
Sequence:CCGGCCTGACCTGATGTCCATTCATCTCGAGATGAATGGACATCAGGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001844.3-1538s1c1
Sequence:CCGGGCTGGCTTCAAAGGTGAACAACTCGAGTTGTTCACCTTTGAAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001844.3-3928s1c1
Sequence:CCGGCACACTCAAGTCCCTCAACAACTCGAGTTGTTGAGGGACTTGAGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001844.3-272s1c1
Sequence:CCGGCAGAGGTATAATGATAAGGATCTCGAGATCCTTATCATTATACCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001844.3-815s1c1
Sequence:CCGGCCTCAAGGATTTCAAGGCAATCTCGAGATTGCCTTGAAATCCTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001844.4-2814s21c1
Sequence:CCGGCTGGAGTGACTGGTCCTAAAGCTCGAGCTTTAGGACCAGTCACTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291580    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001844.4-4743s21c1
Sequence:CCGGCCTGACCTGATGTCCATTCATCTCGAGATGAATGGACATCAGGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001844.4-363s21c1
Sequence:CCGGCTGTCCTCTGCGACGACATAACTCGAGTTATGTCGTCGCAGAGGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001844.4-4626s21c1
Sequence:CCGGGGCCGGTCTGCTTCTTGTAAACTCGAGTTTACAAGAAGCAGACCGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001844.4-1562s21c1
Sequence:CCGGGCTGGCTTCAAAGGTGAACAACTCGAGTTGTTCACCTTTGAAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks