EMAIL THIS PAGE TO A FRIEND

COL3A1

collagen, type III, alpha 1

122 Gene Product Result for
Synonyms: EDS4A
Gene ID:
Human(1281) Summary: This gene encodes the pro-alpha1 chains of type III collagen, a fibrillar collagen that is found in extensible connective tissues such as skin, lung, uterus, intestine and the vascular system, frequently in association with type I collagen. Mutations in this gene are associated with Ehlers-Danlos syndrome types IV, and with aortic and arterial aneurysms. Two transcripts, resulting from the use of alternate polyadenylation signals, have been identified for this gene. [provided by R. Dalgleish, Feb 2008]
Mouse(12825) collagen, type III, alpha 1
Rat(84032) collagen, type III, alpha 1
chicken(396340) collagen, type III, alpha 1
dog(478835) collagen, type III, alpha 1
Horse(100034123) collagen, type III, alpha 1
cow(510833) collagen, type III, alpha 1
domestic cat(101099823) collagen, type III, alpha 1
sheep(443237) collagen, type III, alpha 1
naked mole-rat(101707011) collagen, type III, alpha 1
domestic guinea pig(100727269) collagen, type III, alpha 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000090 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000090 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000090 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009930 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009930 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009930 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000090 Rosetta Predictions human pricing
NM_032085 Rosetta Predictions rat pricing
NM_009930 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000090 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00184432 predicted 3964
2 SASI_Hs02_00301851 predicted 4058
3 SASI_Hs02_00301852 predicted 4212
4 SASI_Hs01_00184434 predicted 4089
5 SASI_Hs01_00184435 predicted 3838
6 SASI_Hs01_00184436 predicted 3851
7 SASI_Hs01_00184437 predicted 4015
8 SASI_Hs01_00184438 predicted 4028
9 SASI_Hs01_00184440 predicted 1409
10 SASI_Hs01_00184441 predicted 199
11 SASI_Hs01_00184433 predicted 3813
12 SASI_Hs01_00184439 predicted 261
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032085 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00059534 predicted 389
2 SASI_Rn01_00059535 predicted 3810
3 SASI_Rn01_00059536 predicted 4319
4 SASI_Rn01_00059537 predicted 3992
5 SASI_Rn01_00059539 predicted 353
6 SASI_Rn02_00265472 predicted 304
7 SASI_Rn01_00059540 predicted 3869
8 SASI_Rn02_00265473 predicted 4298
9 SASI_Rn01_00059541 predicted 213
10 SASI_Rn01_00059542 predicted 3944
11 SASI_Rn01_00059538 predicted 208
12 SASI_Rn01_00059543 predicted 4350
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009930 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00170286 predicted 355
2 SASI_Mm01_00170287 predicted 2932
3 SASI_Mm01_00170290 predicted 214
4 SASI_Mm01_00170291 predicted 325
5 SASI_Mm01_00170292 predicted 565
6 SASI_Mm01_00170293 predicted 3944
7 SASI_Mm01_00170295 predicted 4302
8 SASI_Mm02_00317474 predicted 4223
9 SASI_Mm02_00317475 predicted 4213
10 SASI_Mm02_00317476 predicted 4188
11 SASI_Mm01_00170288 predicted 4320
12 SASI_Mm01_00170289 predicted 4312
13 SASI_Mm01_00170294 predicted 4397
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000090
COL3A1 MISSION shRNA Bacterial Glycerol Stock
collagen, type III, alpha 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000371871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000090.3-293s21c1
Sequence:CCGGCCGTTCTCTGCGATGACATAACTCGAGTTATGTCATCGCAGAGAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371816    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000090.3-4751s21c1
Sequence:CCGGATGTCTCAATGGTGCTATAATCTCGAGATTATAGCACCATTGAGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000090.3-161s21c1
Sequence:CCGGTGCTTCATCCCACTATTATTTCTCGAGAAATAATAGTGGGATGAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000090.x-3806s1c1
Sequence:CCGGACACCGATGAGATTATGACTTCTCGAGAAGTCATAATCTCATCGGTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000090.x-3981s1c1
Sequence:CCGGTGCTATCAAGGTATTCTGTAACTCGAGTTACAGAATACCTTGATAGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003297    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000090.x-5425s1c1
Sequence:CCGGTGTATGTGGTTGTTGATCTTTCTCGAGAAAGATCAACAACCACATACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000090.x-4132s1c1
Sequence:CCGGAGCTACGGCAATCCTGAACTTCTCGAGAAGTTCAGGATTGCCGTAGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000090.x-2897s1c1
Sequence:CCGGGCCAACCAGGAGAGAAGGGATCTCGAGATCCCTTCTCTCCTGGTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000090
COL3A1 MISSION shRNA shRNA Plasmid DNA
collagen, type III, alpha 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000371871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000090.3-293s21c1
Sequence:CCGGCCGTTCTCTGCGATGACATAACTCGAGTTATGTCATCGCAGAGAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371816    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000090.3-4751s21c1
Sequence:CCGGATGTCTCAATGGTGCTATAATCTCGAGATTATAGCACCATTGAGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000090.3-161s21c1
Sequence:CCGGTGCTTCATCCCACTATTATTTCTCGAGAAATAATAGTGGGATGAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000090.x-3806s1c1
Sequence:CCGGACACCGATGAGATTATGACTTCTCGAGAAGTCATAATCTCATCGGTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000090.x-3981s1c1
Sequence:CCGGTGCTATCAAGGTATTCTGTAACTCGAGTTACAGAATACCTTGATAGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003297    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000090.x-5425s1c1
Sequence:CCGGTGTATGTGGTTGTTGATCTTTCTCGAGAAAGATCAACAACCACATACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000090.x-4132s1c1
Sequence:CCGGAGCTACGGCAATCCTGAACTTCTCGAGAAGTTCAGGATTGCCGTAGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000090.x-2897s1c1
Sequence:CCGGGCCAACCAGGAGAGAAGGGATCTCGAGATCCCTTCTCTCCTGGTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000090
COL3A1 MISSION shRNA Lentiviral Transduction Particles
collagen, type III, alpha 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000371871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000090.3-293s21c1
Sequence:CCGGCCGTTCTCTGCGATGACATAACTCGAGTTATGTCATCGCAGAGAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371816    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000090.3-4751s21c1
Sequence:CCGGATGTCTCAATGGTGCTATAATCTCGAGATTATAGCACCATTGAGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000090.3-161s21c1
Sequence:CCGGTGCTTCATCCCACTATTATTTCTCGAGAAATAATAGTGGGATGAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000090.x-3806s1c1
Sequence:CCGGACACCGATGAGATTATGACTTCTCGAGAAGTCATAATCTCATCGGTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000090.x-3981s1c1
Sequence:CCGGTGCTATCAAGGTATTCTGTAACTCGAGTTACAGAATACCTTGATAGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003297    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000090.x-5425s1c1
Sequence:CCGGTGTATGTGGTTGTTGATCTTTCTCGAGAAAGATCAACAACCACATACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000090.x-4132s1c1
Sequence:CCGGAGCTACGGCAATCCTGAACTTCTCGAGAAGTTCAGGATTGCCGTAGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000090.x-2897s1c1
Sequence:CCGGGCCAACCAGGAGAGAAGGGATCTCGAGATCCCTTCTCTCCTGGTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009930
COL3A1 MISSION shRNA Bacterial Glycerol Stock
collagen, type III, alpha 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000091483    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009930.1-4568s1c1
Sequence:CCGGCCAGTGCAAGTGACCAACTAACTCGAGTTAGTTGGTCACTTGCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009930.1-3808s1c1
Sequence:CCGGCTCAAGTCTGTTAATGGACAACTCGAGTTGTCCATTAACAGACTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009930.1-3397s1c1
Sequence:CCGGCGTGGCTCTAATGGCATCAAACTCGAGTTTGATGCCATTAGAGCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009930.1-3906s1c1
Sequence:CCGGCGAACTCAAGAGTGGAGAATACTCGAGTATTCTCCACTCTTGAGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009930.1-179s1c1
Sequence:CCGGCCAACGTAGATGAATTGGGATCTCGAGATCCCAATTCATCTACGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009930
COL3A1 MISSION shRNA shRNA Plasmid DNA
collagen, type III, alpha 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000091483    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009930.1-4568s1c1
Sequence:CCGGCCAGTGCAAGTGACCAACTAACTCGAGTTAGTTGGTCACTTGCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009930.1-3808s1c1
Sequence:CCGGCTCAAGTCTGTTAATGGACAACTCGAGTTGTCCATTAACAGACTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009930.1-3397s1c1
Sequence:CCGGCGTGGCTCTAATGGCATCAAACTCGAGTTTGATGCCATTAGAGCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009930.1-3906s1c1
Sequence:CCGGCGAACTCAAGAGTGGAGAATACTCGAGTATTCTCCACTCTTGAGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009930.1-179s1c1
Sequence:CCGGCCAACGTAGATGAATTGGGATCTCGAGATCCCAATTCATCTACGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009930
COL3A1 MISSION shRNA Lentiviral Transduction Particles
collagen, type III, alpha 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000091483    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009930.1-4568s1c1
Sequence:CCGGCCAGTGCAAGTGACCAACTAACTCGAGTTAGTTGGTCACTTGCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009930.1-3808s1c1
Sequence:CCGGCTCAAGTCTGTTAATGGACAACTCGAGTTGTCCATTAACAGACTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009930.1-3397s1c1
Sequence:CCGGCGTGGCTCTAATGGCATCAAACTCGAGTTTGATGCCATTAGAGCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009930.1-3906s1c1
Sequence:CCGGCGAACTCAAGAGTGGAGAATACTCGAGTATTCTCCACTCTTGAGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009930.1-179s1c1
Sequence:CCGGCCAACGTAGATGAATTGGGATCTCGAGATCCCAATTCATCTACGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks