EMAIL THIS PAGE TO A FRIEND

COL4A1

collagen, type IV, alpha 1

Synonyms: HANAC ICH POREN1 arresten
Gene ID:
Human(1282) Summary: This gene encodes the major type IV alpha collagen chain of basement membranes. Like the other members of the type IV collagen gene family, this gene is organized in a head-to-head conformation with another type IV collagen gene so that each gene pair shares a common promoter. [provided by RefSeq, Jul 2008]
Mouse(12826) collagen, type IV, alpha 1
Rat(290905) collagen, type IV, alpha 1
Zebrafish(554269) collagen, type IV, alpha 1
cow(282191) collagen, type IV, alpha 1
Horse(100066148) collagen, type IV, alpha 1
domestic cat(101096030) collagen, type IV, alpha 1
dog(403496) collagen, type IV, alpha 1
chicken(395530) collagen, type IV, alpha 1
domestic guinea pig(100718624) collagen, type IV, alpha 1
naked mole-rat(101718501) collagen, type IV, alpha 1
sheep(101115552) collagen, type IV, alpha 1
162 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4300825 Anti-COL4A1 antibody produced in rabbit affinity isolated antibody mouse, human
immunohistochemistry pricing
SAB4300738 Anti-Collagen IV antibody produced in rabbit affinity isolated antibody human, mouse
immunohistochemistry, western blot pricing
SAB4500369 Anti-Collagen IV, N-Terminal antibody produced in rabbit affinity isolated antibody human, mouse
immunohistochemistry, western blot pricing
C1926 Monoclonal Anti-Collagen, Type IV antibody produced in mouse clone COL-94, ascites fluid human
dot blot, ELISA, immunohistochemistry, microarray pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001845 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001845 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001845 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009931 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009931 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009931 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001845 Rosetta Predictions human pricing
NM_001135009 Rosetta Predictions rat pricing
XM_001067473 Rosetta Predictions rat pricing
NM_009931 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001845 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00018124 predicted 4267
2 SASI_Hs01_00018125 predicted 771
3 SASI_Hs01_00018126 predicted 2567
4 SASI_Hs02_00332659 predicted 2740
5 SASI_Hs01_00018127 predicted 5188
6 SASI_Hs01_00018128 predicted 4645
7 SASI_Hs01_00018129 predicted 3086
8 SASI_Hs01_00018130 predicted 392
9 SASI_Hs01_00018131 predicted 3424
10 SASI_Hs01_00018132 predicted 627
11 SASI_Hs01_00018133 predicted 254
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001135009 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00259417 predicted 357
2 SASI_Rn02_00259418 predicted 5059
3 SASI_Rn02_00259419 predicted 5225
4 SASI_Rn02_00259420 predicted 1017
5 SASI_Rn02_00259421 predicted 677
6 SASI_Rn02_00259422 predicted 4932
7 SASI_Rn02_00259423 predicted 5288
8 SASI_Rn02_00259424 predicted 1497
9 SASI_Rn02_00259425 predicted 4207
10 SASI_Rn02_00259426 predicted 4925
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001067473 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00321097 predicted 358
2 SASI_Rn02_00321098 predicted 5059
3 SASI_Rn02_00321099 predicted 5225
4 SASI_Rn02_00321100 predicted 1015
5 SASI_Rn02_00321101 predicted 676
6 SASI_Rn02_00321102 predicted 4940
7 SASI_Rn02_00321103 predicted 5289
8 SASI_Rn02_00321104 predicted 1493
9 SASI_Rn02_00321105 predicted 4213
10 SASI_Rn02_00321106 predicted 4924
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009931 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00133923 predicted 1767
2 SASI_Mm01_00133925 predicted 2754
3 SASI_Mm01_00133926 predicted 387
4 SASI_Mm01_00133927 predicted 3246
5 SASI_Mm01_00133928 predicted 1302
6 SASI_Mm02_00317477 predicted 1040
7 SASI_Mm01_00133929 predicted 1407
8 SASI_Mm01_00133930 predicted 580
9 SASI_Mm01_00133931 predicted 3207
10 SASI_Mm01_00133932 predicted 3033
11 SASI_Mm01_00133924 predicted 2641
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001845
COL4A1 MISSION shRNA Bacterial Glycerol Stock
collagen, type IV, alpha 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000108415    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001845.3-5475s1c1
Sequence:CCGGCCCAGAGATAAATGTTTGTTTCTCGAGAAACAAACATTTATCTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001845.3-1810s1c1
Sequence:CCGGCCGGGTTCTGTAGGATTGAAACTCGAGTTTCAATCCTACAGAACCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001845.3-2841s1c1
Sequence:CCGGCCCTGGCTTGAAAGGTGATAACTCGAGTTATCACCTTTCAAGCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001845.3-3859s1c1
Sequence:CCGGCCTGGGATTGATGGAGTTAAACTCGAGTTTAACTCCATCAATCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001845.3-1434s1c1
Sequence:CCGGGCCAGGATTTATAGGCGAAATCTCGAGATTTCGCCTATAAATCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001845.4-1723s21c1
Sequence:CCGGATTTCGACTTGCGGCTCAAAGCTCGAGCTTTGAGCCGCAAGTCGAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420613    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001845.4-5257s21c1
Sequence:CCGGATAGGAATTTGCGTAACTAACCTCGAGGTTAGTTACGCAAATTCCTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001845
COL4A1 MISSION shRNA shRNA Plasmid DNA
collagen, type IV, alpha 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000108415    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001845.3-5475s1c1
Sequence:CCGGCCCAGAGATAAATGTTTGTTTCTCGAGAAACAAACATTTATCTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001845.3-1810s1c1
Sequence:CCGGCCGGGTTCTGTAGGATTGAAACTCGAGTTTCAATCCTACAGAACCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001845.3-2841s1c1
Sequence:CCGGCCCTGGCTTGAAAGGTGATAACTCGAGTTATCACCTTTCAAGCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001845.3-3859s1c1
Sequence:CCGGCCTGGGATTGATGGAGTTAAACTCGAGTTTAACTCCATCAATCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001845.3-1434s1c1
Sequence:CCGGGCCAGGATTTATAGGCGAAATCTCGAGATTTCGCCTATAAATCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001845.4-1723s21c1
Sequence:CCGGATTTCGACTTGCGGCTCAAAGCTCGAGCTTTGAGCCGCAAGTCGAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420613    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001845.4-5257s21c1
Sequence:CCGGATAGGAATTTGCGTAACTAACCTCGAGGTTAGTTACGCAAATTCCTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001845
COL4A1 MISSION shRNA Lentiviral Transduction Particles
collagen, type IV, alpha 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000108415    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001845.3-5475s1c1
Sequence:CCGGCCCAGAGATAAATGTTTGTTTCTCGAGAAACAAACATTTATCTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001845.3-1810s1c1
Sequence:CCGGCCGGGTTCTGTAGGATTGAAACTCGAGTTTCAATCCTACAGAACCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001845.3-2841s1c1
Sequence:CCGGCCCTGGCTTGAAAGGTGATAACTCGAGTTATCACCTTTCAAGCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001845.3-3859s1c1
Sequence:CCGGCCTGGGATTGATGGAGTTAAACTCGAGTTTAACTCCATCAATCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001845.3-1434s1c1
Sequence:CCGGGCCAGGATTTATAGGCGAAATCTCGAGATTTCGCCTATAAATCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001845.4-1723s21c1
Sequence:CCGGATTTCGACTTGCGGCTCAAAGCTCGAGCTTTGAGCCGCAAGTCGAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420613    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001845.4-5257s21c1
Sequence:CCGGATAGGAATTTGCGTAACTAACCTCGAGGTTAGTTACGCAAATTCCTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009931
VALIDATED
COL4A1 MISSION shRNA Bacterial Glycerol Stock
collagen, type IV, alpha 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000090433    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009931.1-5235s1c1
Sequence:CCGGCCTAGAATTATATCCTGTGTACTCGAGTACACAGGATATAATTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009931.1-1642s1c1
Sequence:CCGGGCAGAGATGGTCTTGAAGGATCTCGAGATCCTTCAAGACCATCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009931.1-3157s1c1
Sequence:CCGGCCAAAGGATCAGTTGGAGGAACTCGAGTTCCTCCAACTGATCCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009931.1-4996s1c1
Sequence:CCGGGCAATTACTACGCAAATGCTTCTCGAGAAGCATTTGCGTAGTAATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009931.1-4535s1c1
Sequence:CCGGCCATGGATACTCTCTGCTCTACTCGAGTAGAGCAGAGAGTATCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009931.2-4631s21c1
Sequence:CCGGCCATGGATACTCTCTGCTCTACTCGAGTAGAGCAGAGAGTATCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009931.2-953s21c1
Sequence:CCGGTCCTGGACAGGCACAAGTTAACTCGAGTTAACTTGTGCCTGTCCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009931.2-3102s21c1
Sequence:CCGGATCGGACCCACTGGTGATAAACTCGAGTTTATCACCAGTGGGTCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327103    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009931.2-5331s21c1
Sequence:CCGGCCTAGAATTATATCCTGTGTACTCGAGTACACAGGATATAATTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009931.2-5092s21c1
Sequence:CCGGGCAATTACTACGCAAATGCTTCTCGAGAAGCATTTGCGTAGTAATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009931
VALIDATED
COL4A1 MISSION shRNA shRNA Plasmid DNA
collagen, type IV, alpha 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000090433    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009931.1-5235s1c1
Sequence:CCGGCCTAGAATTATATCCTGTGTACTCGAGTACACAGGATATAATTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009931.1-1642s1c1
Sequence:CCGGGCAGAGATGGTCTTGAAGGATCTCGAGATCCTTCAAGACCATCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009931.1-3157s1c1
Sequence:CCGGCCAAAGGATCAGTTGGAGGAACTCGAGTTCCTCCAACTGATCCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009931.1-4996s1c1
Sequence:CCGGGCAATTACTACGCAAATGCTTCTCGAGAAGCATTTGCGTAGTAATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009931.1-4535s1c1
Sequence:CCGGCCATGGATACTCTCTGCTCTACTCGAGTAGAGCAGAGAGTATCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009931.2-4631s21c1
Sequence:CCGGCCATGGATACTCTCTGCTCTACTCGAGTAGAGCAGAGAGTATCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009931.2-953s21c1
Sequence:CCGGTCCTGGACAGGCACAAGTTAACTCGAGTTAACTTGTGCCTGTCCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009931.2-3102s21c1
Sequence:CCGGATCGGACCCACTGGTGATAAACTCGAGTTTATCACCAGTGGGTCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327103    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009931.2-5331s21c1
Sequence:CCGGCCTAGAATTATATCCTGTGTACTCGAGTACACAGGATATAATTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009931.2-5092s21c1
Sequence:CCGGGCAATTACTACGCAAATGCTTCTCGAGAAGCATTTGCGTAGTAATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009931
VALIDATED
COL4A1 MISSION shRNA Lentiviral Transduction Particles
collagen, type IV, alpha 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000090433    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009931.1-5235s1c1
Sequence:CCGGCCTAGAATTATATCCTGTGTACTCGAGTACACAGGATATAATTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009931.1-1642s1c1
Sequence:CCGGGCAGAGATGGTCTTGAAGGATCTCGAGATCCTTCAAGACCATCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009931.1-3157s1c1
Sequence:CCGGCCAAAGGATCAGTTGGAGGAACTCGAGTTCCTCCAACTGATCCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009931.1-4996s1c1
Sequence:CCGGGCAATTACTACGCAAATGCTTCTCGAGAAGCATTTGCGTAGTAATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009931.1-4535s1c1
Sequence:CCGGCCATGGATACTCTCTGCTCTACTCGAGTAGAGCAGAGAGTATCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009931.2-4631s21c1
Sequence:CCGGCCATGGATACTCTCTGCTCTACTCGAGTAGAGCAGAGAGTATCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009931.2-953s21c1
Sequence:CCGGTCCTGGACAGGCACAAGTTAACTCGAGTTAACTTGTGCCTGTCCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009931.2-3102s21c1
Sequence:CCGGATCGGACCCACTGGTGATAAACTCGAGTTTATCACCAGTGGGTCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327103    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009931.2-5331s21c1
Sequence:CCGGCCTAGAATTATATCCTGTGTACTCGAGTACACAGGATATAATTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009931.2-5092s21c1
Sequence:CCGGGCAATTACTACGCAAATGCTTCTCGAGAAGCATTTGCGTAGTAATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks