EMAIL THIS PAGE TO A FRIEND

COL4A2

collagen, type IV, alpha 2

78 Gene Product Result for
Synonyms: ICH POREN2
UniProtKB ID: P08572, Q14052, Q548C3, Q5VZA9, Q66K23
Gene ID:
Human(1284) Summary: This gene encodes one of the six subunits of type IV collagen, the major structural component of basement membranes. The C-terminal portion of the protein, known as canstatin, is an inhibitor of angiogenesis and tumor growth. Like the other members of the type IV collagen gene family, this gene is organized in a head-to-head conformation with another type IV collagen gene so that each gene pair shares a common promoter. [provided by RefSeq, Jul 2008]
Mouse(12827) collagen, type IV, alpha 2
Rat(306628) collagen, type IV, alpha 2
sheep(101115805) collagen, type IV, alpha 2
Domestic Rabbit(100358522) collagen, type IV, alpha 2
naked mole-rat(101721657) collagen, type IV, alpha 2
domestic guinea pig(100730120) collagen, type IV, alpha 2
Zebrafish(553355) collagen, type IV, alpha 2
chicken(418752) collagen, type IV, alpha 2
dog(403843) collagen, type IV, alpha 2
Horse(100066264) collagen, type IV, alpha 2
cow(508632) collagen, type IV, alpha 2
domestic cat(101096282) collagen, type IV, alpha 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009932 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009932 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009932 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001846 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001846 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001846 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001846 Rosetta Predictions human pricing
XM_001076134 Rosetta Predictions rat pricing
XM_225043 Rosetta Predictions rat pricing
NM_009932 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001846 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00116270 predicted 1092
2 SASI_Hs01_00116271 predicted 795
3 SASI_Hs01_00116272 predicted 5151
4 SASI_Hs01_00116273 predicted 782
5 SASI_Hs02_00332660 predicted 2782
6 SASI_Hs01_00116274 predicted 5138
7 SASI_Hs01_00116275 predicted 3566
8 SASI_Hs01_00116277 predicted 4140
9 SASI_Hs01_00116278 predicted 5029
10 SASI_Hs01_00116279 predicted 3290
11 SASI_Hs01_00116276 predicted 1140
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076134 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00352161 predicted 2240
2 SASI_Rn02_00352162 predicted 5435
3 SASI_Rn02_00352163 predicted 1048
4 SASI_Rn02_00352164 predicted 5254
5 SASI_Rn02_00352165 predicted 1079
6 SASI_Rn02_00352166 predicted 780
7 SASI_Rn02_00352167 predicted 5111
8 SASI_Rn02_00352168 predicted 1088
9 SASI_Rn02_00352169 predicted 2287
10 SASI_Rn02_00352170 predicted 678
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_225043 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00382457 predicted 2241
2 SASI_Rn02_00382458 predicted 5430
3 SASI_Rn02_00382459 predicted 1055
4 SASI_Rn02_00382460 predicted 5247
5 SASI_Rn02_00382461 predicted 1077
6 SASI_Rn02_00382462 predicted 781
7 SASI_Rn02_00382463 predicted 5099
8 SASI_Rn02_00382464 predicted 1082
9 SASI_Rn02_00382465 predicted 2291
10 SASI_Rn02_00382466 predicted 678
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009932 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00092026 predicted 2086
2 SASI_Mm01_00092027 predicted 910
3 SASI_Mm02_00317478 predicted 4969
4 SASI_Mm01_00092029 predicted 2911
5 SASI_Mm01_00092030 predicted 4976
6 SASI_Mm02_00317479 predicted 2429
7 SASI_Mm01_00092033 predicted 4783
8 SASI_Mm02_00317480 predicted 4859
9 SASI_Mm01_00092034 predicted 532
10 SASI_Mm01_00092035 predicted 1547
11 SASI_Mm01_00092028 predicted 1756
12 SASI_Mm01_00092031 predicted 5322
13 SASI_Mm01_00092032 predicted 661
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009932
VALIDATED
COL4A2 MISSION shRNA Bacterial Glycerol Stock
collagen, type IV, alpha 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000091293    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009932.2-5512s1c1
Sequence:CCGGCCAAAGTTGATCTTAGTGTTTCTCGAGAAACACTAAGATCAACTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009932.2-1306s1c1
Sequence:CCGGCGTCGGAGATGAAGATTCAATCTCGAGATTGAATCTTCATCTCCGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009932.2-896s1c1
Sequence:CCGGCCATCTGACATCACACTTGTTCTCGAGAACAAGTGTGATGTCAGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009932.2-4984s1c1
Sequence:CCGGCGGATATTCATTCCTCATGTACTCGAGTACATGAGGAATGAATATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009932.2-1305s1c1
Sequence:CCGGCCGTCGGAGATGAAGATTCAACTCGAGTTGAATCTTCATCTCCGACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009932
VALIDATED
COL4A2 MISSION shRNA shRNA Plasmid DNA
collagen, type IV, alpha 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000091293    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009932.2-5512s1c1
Sequence:CCGGCCAAAGTTGATCTTAGTGTTTCTCGAGAAACACTAAGATCAACTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009932.2-1306s1c1
Sequence:CCGGCGTCGGAGATGAAGATTCAATCTCGAGATTGAATCTTCATCTCCGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009932.2-896s1c1
Sequence:CCGGCCATCTGACATCACACTTGTTCTCGAGAACAAGTGTGATGTCAGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009932.2-4984s1c1
Sequence:CCGGCGGATATTCATTCCTCATGTACTCGAGTACATGAGGAATGAATATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009932.2-1305s1c1
Sequence:CCGGCCGTCGGAGATGAAGATTCAACTCGAGTTGAATCTTCATCTCCGACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009932
VALIDATED
COL4A2 MISSION shRNA Lentiviral Transduction Particles
collagen, type IV, alpha 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000091293    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009932.2-5512s1c1
Sequence:CCGGCCAAAGTTGATCTTAGTGTTTCTCGAGAAACACTAAGATCAACTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009932.2-1306s1c1
Sequence:CCGGCGTCGGAGATGAAGATTCAATCTCGAGATTGAATCTTCATCTCCGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009932.2-896s1c1
Sequence:CCGGCCATCTGACATCACACTTGTTCTCGAGAACAAGTGTGATGTCAGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009932.2-4984s1c1
Sequence:CCGGCGGATATTCATTCCTCATGTACTCGAGTACATGAGGAATGAATATCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009932.2-1305s1c1
Sequence:CCGGCCGTCGGAGATGAAGATTCAACTCGAGTTGAATCTTCATCTCCGACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001846
COL4A2 MISSION shRNA Bacterial Glycerol Stock
collagen, type IV, alpha 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000108280    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001846.1-5890s1c1
Sequence:CCGGCCTGCTTTCTACGCCAATGTTCTCGAGAACATTGGCGTAGAAAGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001846.1-4144s1c1
Sequence:CCGGCCAGGGATATTTGGCCTGAAACTCGAGTTTCAGGCCAAATATCCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001846.1-385s1c1
Sequence:CCGGGCGGGTGTGAAGAAGTTTGATCTCGAGATCAAACTTCTTCACACCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001846.1-1099s1c1
Sequence:CCGGCCAGATCAGTACAAGGGTGAACTCGAGTTCACCCTTGTACTGATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001846.1-3631s1c1
Sequence:CCGGCCAGGTCTGAAGGGATTCTTTCTCGAGAAAGAATCCCTTCAGACCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001846
COL4A2 MISSION shRNA shRNA Plasmid DNA
collagen, type IV, alpha 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000108280    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001846.1-5890s1c1
Sequence:CCGGCCTGCTTTCTACGCCAATGTTCTCGAGAACATTGGCGTAGAAAGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001846.1-4144s1c1
Sequence:CCGGCCAGGGATATTTGGCCTGAAACTCGAGTTTCAGGCCAAATATCCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001846.1-385s1c1
Sequence:CCGGGCGGGTGTGAAGAAGTTTGATCTCGAGATCAAACTTCTTCACACCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001846.1-1099s1c1
Sequence:CCGGCCAGATCAGTACAAGGGTGAACTCGAGTTCACCCTTGTACTGATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001846.1-3631s1c1
Sequence:CCGGCCAGGTCTGAAGGGATTCTTTCTCGAGAAAGAATCCCTTCAGACCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001846
COL4A2 MISSION shRNA Lentiviral Transduction Particles
collagen, type IV, alpha 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000108280    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001846.1-5890s1c1
Sequence:CCGGCCTGCTTTCTACGCCAATGTTCTCGAGAACATTGGCGTAGAAAGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001846.1-4144s1c1
Sequence:CCGGCCAGGGATATTTGGCCTGAAACTCGAGTTTCAGGCCAAATATCCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001846.1-385s1c1
Sequence:CCGGGCGGGTGTGAAGAAGTTTGATCTCGAGATCAAACTTCTTCACACCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001846.1-1099s1c1
Sequence:CCGGCCAGATCAGTACAAGGGTGAACTCGAGTTCACCCTTGTACTGATCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001846.1-3631s1c1
Sequence:CCGGCCAGGTCTGAAGGGATTCTTTCTCGAGAAAGAATCCCTTCAGACCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)