EMAIL THIS PAGE TO A FRIEND

COL4A3

collagen, type IV, alpha 3 (Goodpasture antigen)

240 Gene Product Result for
Gene ID:
Human(1285) Summary: Type IV collagen, the major structural component of basement membranes, is a multimeric protein composed of 3 alpha subunits. These subunits are encoded by 6 different genes, alpha 1 through alpha 6, each of which can form a triple helix structure with 2 other subunits to form type IV collagen. This gene encodes alpha 3. In the Goodpasture syndrome, autoantibodies bind to the collagen molecules in the basement membranes of alveoli and glomeruli. The epitopes that elicit these autoantibodies are localized largely to the non-collagenous C-terminal domain of the protein. A specific kinase phosphorylates amino acids in this same C-terminal region and the expression of this kinase is upregulated during pathogenesis. This gene is also linked to an autosomal recessive form of Alport syndrome. The mutations contributing to this syndrome are also located within the exons that encode this C-terminal region. Like the other members of the type IV collagen gene family, this gene is organized in a head-to-head conformation with another type IV collagen gene so that each gene pair shares a common promoter. [provided by RefSeq, Jun 2010]
Mouse(12828) collagen, type IV, alpha 3
Rat(363265) collagen, type IV, alpha 3
Zebrafish(553354) collagen, type IV, alpha 3
chicken(424797) collagen, type IV, alpha 3 (Goodpasture antigen)
dog(403842) collagen, type IV, alpha 3 (Goodpasture antigen)
domestic cat(101087512) collagen, type IV, alpha 3 (Goodpasture antigen)
Horse(100037402) collagen, type IV, alpha 3 (Goodpasture antigen)
cow(317711) collagen, type IV, alpha 3 (Goodpasture antigen)
domestic guinea pig(100732315) collagen, type IV, alpha 3 (Goodpasture antigen)
naked mole-rat(101709004) collagen, type IV, alpha 3 (Goodpasture antigen)
sheep(101102790) collagen, type IV, alpha 3 (Goodpasture antigen)
sheep(443526) collagen, type IV, alpha 3 (Goodpasture antigen)
Domestic Rabbit(100009082) collagen, type IV, alpha 3 (Goodpasture antigen)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007734 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007734 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007734 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000091 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000091 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000091 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU095961 MISSION® esiRNA esiRNA human COL4A3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000091 Rosetta Predictions human pricing
NM_031362 Rosetta Predictions human pricing
NM_031365 Rosetta Predictions human pricing
NM_031366 Rosetta Predictions human pricing
XM_001061656 Rosetta Predictions rat pricing
XM_343607 Rosetta Predictions rat pricing
NM_007734 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000091 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00046338 predicted 2239
2 SASI_Hs01_00046339 predicted 4121
3 SASI_Hs01_00046340 predicted 2829
4 SASI_Hs01_00046341 predicted 998
5 SASI_Hs01_00046342 predicted 3940
6 SASI_Hs01_00046343 predicted 1000
7 SASI_Hs01_00046344 predicted 1524
8 SASI_Hs01_00046345 predicted 2973
9 SASI_Hs01_00046346 predicted 1774
10 SASI_Hs01_00046347 predicted 3087
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031362 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00164624 predicted 2239
2 SASI_Hs01_00164625 predicted 4122
3 SASI_Hs01_00164626 predicted 2822
4 SASI_Hs01_00164627 predicted 5164
5 SASI_Hs02_00358766 predicted 998
6 SASI_Hs01_00164628 predicted 3938
7 SASI_Hs01_00164629 predicted 994
8 SASI_Hs01_00164631 predicted 1517
9 SASI_Hs01_00164632 predicted 2977
10 SASI_Hs01_00164633 predicted 3089
11 SASI_Hs01_00164630 predicted 5155
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031365 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00061281 predicted 2237
2 SASI_Hs01_00061282 predicted 4119
3 SASI_Hs01_00061283 predicted 2825
4 SASI_Hs01_00061284 predicted 996
5 SASI_Hs01_00061285 predicted 3934
6 SASI_Hs01_00061286 predicted 995
7 SASI_Hs01_00061287 predicted 1518
8 SASI_Hs01_00061288 predicted 2973
9 SASI_Hs01_00061289 predicted 1781
10 SASI_Hs01_00061290 predicted 3092
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031366 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00110939 predicted 2239
2 SASI_Hs01_00110940 predicted 4124
3 SASI_Hs01_00110941 predicted 2823
4 SASI_Hs01_00110942 predicted 996
5 SASI_Hs01_00110943 predicted 3937
6 SASI_Hs01_00110944 predicted 1000
7 SASI_Hs01_00110945 predicted 1517
8 SASI_Hs01_00110946 predicted 2971
9 SASI_Hs01_00110947 predicted 1775
10 SASI_Hs01_00110948 predicted 3094
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001061656 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00300906 predicted 1030
2 SASI_Rn02_00300907 predicted 3960
3 SASI_Rn02_00300908 predicted 3789
4 SASI_Rn02_00300909 predicted 1924
5 SASI_Rn02_00300910 predicted 2866
6 SASI_Rn02_00300911 predicted 4666
7 SASI_Rn02_00300912 predicted 4482
8 SASI_Rn02_00300913 predicted 4255
9 SASI_Rn02_00300914 predicted 2346
10 SASI_Rn02_00300915 predicted 4320
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343607 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00396108 predicted 1035
2 SASI_Rn02_00396109 predicted 3967
3 SASI_Rn02_00396110 predicted 3789
4 SASI_Rn02_00396111 predicted 1009
5 SASI_Rn02_00396112 predicted 1925
6 SASI_Rn02_00396113 predicted 2865
7 SASI_Rn02_00396114 predicted 2345
8 SASI_Rn02_00396115 predicted 2879
9 SASI_Rn02_00396116 predicted 4042
10 SASI_Rn02_00396117 predicted 475
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007734 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00312328 predicted 720
2 SASI_Mm01_00069045 predicted 4922
3 SASI_Mm01_00069046 predicted 4904
4 SASI_Mm01_00069047 predicted 4352
5 SASI_Mm01_00069048 predicted 3577
6 SASI_Mm02_00312329 predicted 4788
7 SASI_Mm01_00069050 predicted 4917
8 SASI_Mm02_00312330 predicted 3308
9 SASI_Mm01_00069051 predicted 1572
10 SASI_Mm01_00069052 predicted 1771
11 SASI_Mm01_00069044 predicted 3197
12 SASI_Mm01_00069049 predicted 4714
13 SASI_Mm01_00069053 predicted 3018
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007734
COL4A3 MISSION shRNA Bacterial Glycerol Stock
collagen, type IV, alpha 3 (Goodpasture antigen)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000090818    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007734.1-6233s1c1
Sequence:CCGGCCAGGAAATAATCAGGTTTATCTCGAGATAAACCTGATTATTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007734.1-1558s1c1
Sequence:CCGGCCAGGCTTGAAAGGGAGTAAACTCGAGTTTACTCCCTTTCAAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007734.1-4333s1c1
Sequence:CCGGCCTGGATTTCTTGGGCCAATTCTCGAGAATTGGCCCAAGAAATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007734.1-4866s1c1
Sequence:CCGGGCCGTTCTTATTCTGTAACATCTCGAGATGTTACAGAATAAGAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007734.1-2821s1c1
Sequence:CCGGCCCGGCTTGAATGGATTGAAACTCGAGTTTCAATCCATTCAAGCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007734
COL4A3 MISSION shRNA shRNA Plasmid DNA
collagen, type IV, alpha 3 (Goodpasture antigen)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000090818    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007734.1-6233s1c1
Sequence:CCGGCCAGGAAATAATCAGGTTTATCTCGAGATAAACCTGATTATTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007734.1-1558s1c1
Sequence:CCGGCCAGGCTTGAAAGGGAGTAAACTCGAGTTTACTCCCTTTCAAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007734.1-4333s1c1
Sequence:CCGGCCTGGATTTCTTGGGCCAATTCTCGAGAATTGGCCCAAGAAATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007734.1-4866s1c1
Sequence:CCGGGCCGTTCTTATTCTGTAACATCTCGAGATGTTACAGAATAAGAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007734.1-2821s1c1
Sequence:CCGGCCCGGCTTGAATGGATTGAAACTCGAGTTTCAATCCATTCAAGCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007734
COL4A3 MISSION shRNA Lentiviral Transduction Particles
collagen, type IV, alpha 3 (Goodpasture antigen)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000090818    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007734.1-6233s1c1
Sequence:CCGGCCAGGAAATAATCAGGTTTATCTCGAGATAAACCTGATTATTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007734.1-1558s1c1
Sequence:CCGGCCAGGCTTGAAAGGGAGTAAACTCGAGTTTACTCCCTTTCAAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007734.1-4333s1c1
Sequence:CCGGCCTGGATTTCTTGGGCCAATTCTCGAGAATTGGCCCAAGAAATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007734.1-4866s1c1
Sequence:CCGGGCCGTTCTTATTCTGTAACATCTCGAGATGTTACAGAATAAGAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007734.1-2821s1c1
Sequence:CCGGCCCGGCTTGAATGGATTGAAACTCGAGTTTCAATCCATTCAAGCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000091
COL4A3 MISSION shRNA Bacterial Glycerol Stock
collagen, type IV, alpha 3 (Goodpasture antigen)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000083484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000091.2-4749s1c1
Sequence:CCGGCCAATGAACATGGCTCCCATTCTCGAGAATGGGAGCCATGTTCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000091.2-3093s1c1
Sequence:CCGGCCAGGTTTAAAGGGCCTCAAACTCGAGTTTGAGGCCCTTTAAACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000091.2-4646s1c1
Sequence:CCGGGCGATTTACCACAATGCCATTCTCGAGAATGGCATTGTGGTAAATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000091.2-606s1c1
Sequence:CCGGGCTGCTGGTTTGAAAGGACAACTCGAGTTGTCCTTTCAAACCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083483    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000091.2-6514s1c1
Sequence:CCGGGCTCTGTAATAATCTCACATACTCGAGTATGTGAGATTATTACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000091.3-3181s21c1
Sequence:CCGGGAACCAGGACTGCGTGGTATACTCGAGTATACCACGCAGTCCTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424068    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000091.3-5279s21c1
Sequence:CCGGCCATGATGACTTAGTACAAAGCTCGAGCTTTGTACTAAGTCATCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000091.3-5018s21c1
Sequence:CCGGGAGGAACGTGCAACTACTATTCTCGAGAATAGTAGTTGCACGTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000091
COL4A3 MISSION shRNA shRNA Plasmid DNA
collagen, type IV, alpha 3 (Goodpasture antigen)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000083484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000091.2-4749s1c1
Sequence:CCGGCCAATGAACATGGCTCCCATTCTCGAGAATGGGAGCCATGTTCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000091.2-3093s1c1
Sequence:CCGGCCAGGTTTAAAGGGCCTCAAACTCGAGTTTGAGGCCCTTTAAACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000091.2-4646s1c1
Sequence:CCGGGCGATTTACCACAATGCCATTCTCGAGAATGGCATTGTGGTAAATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000091.2-606s1c1
Sequence:CCGGGCTGCTGGTTTGAAAGGACAACTCGAGTTGTCCTTTCAAACCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083483    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000091.2-6514s1c1
Sequence:CCGGGCTCTGTAATAATCTCACATACTCGAGTATGTGAGATTATTACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000091.3-3181s21c1
Sequence:CCGGGAACCAGGACTGCGTGGTATACTCGAGTATACCACGCAGTCCTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424068    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000091.3-5279s21c1
Sequence:CCGGCCATGATGACTTAGTACAAAGCTCGAGCTTTGTACTAAGTCATCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000091.3-5018s21c1
Sequence:CCGGGAGGAACGTGCAACTACTATTCTCGAGAATAGTAGTTGCACGTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000091
COL4A3 MISSION shRNA Lentiviral Transduction Particles
collagen, type IV, alpha 3 (Goodpasture antigen)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000083484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000091.2-4749s1c1
Sequence:CCGGCCAATGAACATGGCTCCCATTCTCGAGAATGGGAGCCATGTTCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000091.2-3093s1c1
Sequence:CCGGCCAGGTTTAAAGGGCCTCAAACTCGAGTTTGAGGCCCTTTAAACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000091.2-4646s1c1
Sequence:CCGGGCGATTTACCACAATGCCATTCTCGAGAATGGCATTGTGGTAAATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000091.2-606s1c1
Sequence:CCGGGCTGCTGGTTTGAAAGGACAACTCGAGTTGTCCTTTCAAACCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083483    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000091.2-6514s1c1
Sequence:CCGGGCTCTGTAATAATCTCACATACTCGAGTATGTGAGATTATTACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000091.3-3181s21c1
Sequence:CCGGGAACCAGGACTGCGTGGTATACTCGAGTATACCACGCAGTCCTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424068    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000091.3-5279s21c1
Sequence:CCGGCCATGATGACTTAGTACAAAGCTCGAGCTTTGTACTAAGTCATCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000091.3-5018s21c1
Sequence:CCGGGAGGAACGTGCAACTACTATTCTCGAGAATAGTAGTTGCACGTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks