EMAIL THIS PAGE TO A FRIEND

COL4A3BP

collagen, type IV, alpha 3 (Goodpasture antigen) binding protein

75 Gene Product Result for
Synonyms: CERT CERTL GPBP STARD11
Gene ID:
Human(10087) Summary: This gene encodes a kinase that specifically phosphorylates the N-terminal region of the non-collagenous domain of the alpha 3 chain of type IV collagen, known as the Goodpasture antigen. Goodpasture disease is the result of an autoimmune response directed at this antigen. One isoform of this protein is also involved in ceramide intracellular transport. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(68018) collagen, type IV, alpha 3 (Goodpasture antigen) binding protein
Rat(365652) collagen, type IV, alpha 3 (Goodpasture antigen) binding protein
sheep(101105001) collagen, type IV, alpha 3 (Goodpasture antigen) binding protein
Domestic Rabbit(100357279) collagen, type IV, alpha 3 (Goodpasture antigen) binding protein
naked mole-rat(101718242) collagen, type IV, alpha 3 (Goodpasture antigen) binding protein
domestic guinea pig(100727340) collagen, type IV, alpha 3 (Goodpasture antigen) binding protein
chicken(427209) collagen, type IV, alpha 3 (Goodpasture antigen) binding protein
domestic cat(101099355) collagen, type IV, alpha 3 (Goodpasture antigen) binding protein
cow(286797) collagen, type IV, alpha 3 (Goodpasture antigen) binding protein
Horse(100065557) collagen, type IV, alpha 3 (Goodpasture antigen) binding protein
dog(612799) collagen, type IV, alpha 3 (Goodpasture antigen) binding protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
GW22128A Anti-CERT (ab1) antibody produced in chicken affinity isolated antibody, buffered aqueous solution mouse, rat, human
western blot pricing
GW22128B Anti-CERT (ab2) antibody produced in chicken affinity isolated antibody, buffered aqueous solution mouse, human, rat
western blot pricing
C5245 Anti-COL4A3BP (101-115) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
C5370 Anti-COL4A3BP (301-315) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB2500257 Anti-COL4A3BP (AA 396-411) antibody produced in goat affinity isolated antibody, buffered aqueous solution human, bovine, canine
ELISA, western blot pricing
SAB2500258 Anti-COL4A3BP (AA 662-672) antibody produced in goat affinity isolated antibody, buffered aqueous solution human, mouse
ELISA, western blot pricing
AV52418 Anti-COL4A3BP antibody produced in rabbit affinity isolated antibody rat, bovine, canine, mouse, horse, human, guinea pig, rabbit
western blot pricing
HPA035645 Anti-COL4A3BP antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
HPA042608 Anti-COL4A3BP antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence, western blot pricing
WH0010087M2 Monoclonal Anti-COL4A3BP antibody produced in mouse clone 1A1, purified immunoglobulin, buffered aqueous solution human
ELISA pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005713 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005713 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005713 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023420 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023420 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023420 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU069681 MISSION® esiRNA esiRNA human COL4A3BP (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005713 Rosetta Predictions human pricing
NM_031361 Rosetta Predictions human pricing
NM_001108935 Rosetta Predictions rat pricing
NM_023420 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005713 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00081949 predicted 654
2 SASI_Hs01_00081951 predicted 752
3 SASI_Hs01_00081952 predicted 1949
4 SASI_Hs01_00081953 predicted 935
5 SASI_Hs01_00081954 predicted 735
6 SASI_Hs01_00081955 predicted 1859
7 SASI_Hs01_00081957 predicted 1105
8 SASI_Hs01_00081958 predicted 903
9 SASI_Hs02_00340133 predicted 2120
10 SASI_Hs02_00340134 predicted 1055
11 SASI_Hs01_00081950 predicted 650
12 SASI_Hs01_00081956 predicted 1233
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031361 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00234418 predicted 657
2 SASI_Hs01_00234420 predicted 747
3 SASI_Hs01_00234421 predicted 1862
4 SASI_Hs01_00234422 predicted 943
5 SASI_Hs01_00234423 predicted 732
6 SASI_Hs01_00234424 predicted 1780
7 SASI_Hs01_00234426 predicted 1109
8 SASI_Hs01_00234427 predicted 907
9 SASI_Hs02_00358764 predicted 2037
10 SASI_Hs02_00358765 predicted 1055
11 SASI_Hs01_00234419 predicted 652
12 SASI_Hs01_00234425 predicted 1228
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108935 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00243534 predicted 1352
2 SASI_Rn02_00243535 predicted 575
3 SASI_Rn02_00243536 predicted 1876
4 SASI_Rn02_00243537 predicted 2215
5 SASI_Rn02_00243538 predicted 917
6 SASI_Rn02_00243539 predicted 1204
7 SASI_Rn02_00243540 predicted 1867
8 SASI_Rn02_00243541 predicted 1934
9 SASI_Rn02_00243542 predicted 1592
10 SASI_Rn02_00243543 predicted 1123
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023420 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00147502 predicted 1374
2 SASI_Mm02_00327111 predicted 1091
3 SASI_Mm01_00147503 predicted 1930
4 SASI_Mm01_00147505 predicted 1145
5 SASI_Mm01_00147506 predicted 2236
6 SASI_Mm01_00147507 predicted 1612
7 SASI_Mm01_00147508 predicted 1310
8 SASI_Mm01_00147509 predicted 1486
9 SASI_Mm01_00147511 predicted 771
10 SASI_Mm02_00327112 predicted 702
11 SASI_Mm01_00147504 predicted 1097
12 SASI_Mm01_00147510 predicted 2157
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005713
VALIDATED
COL4A3BP MISSION shRNA Bacterial Glycerol Stock
collagen, type IV, alpha 3 (Goodpasture antigen) binding protein
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_005713.2-1923s21c1
Sequence:GTACCGGGCTTCTCAGCGAGACGTATTACTCGAGTAATACGTCTCGCTGAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315402    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005713.2-2498s21c1
Sequence:CCGGCTTGCTCAGCATATAACTATACTCGAGTATAGTTATATGCTGAGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_005713.2-1074s21c1
Sequence:CCGGCATAGTACCAACGGCAATAAACTCGAGTTTATTGCCGTTGGTACTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005713.2-1278s21c1
Sequence:CCGGAGAACAGAGGAAGCATATAAACTCGAGTTTATATGCTTCCTCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005713.2-1786s21c1
Sequence:CCGGGACATGAAGTCTGCAATTATTCTCGAGAATAATTGCAGACTTCATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005713.2-2214s21c1
Sequence:CCGGGCAAAGCGAGAGTATCCTAAACTCGAGTTTAGGATACTCTCGCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380482    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005713.2-2375s21c1
Sequence:GTACCGGAGCTGGAACGTAGGATCTATACTCGAGTATAGATCCTACGTTCCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005713.2-949s21c1
Sequence:GTACCGGACACGCTACAGAAGTACTTTGCTCGAGCAAAGTACTTCTGTAGCGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005713.2-1330s21c1
Sequence:GTACCGGACTTTGGAGGACCAGATTATGCTCGAGCATAATCTGGTCCTCCAAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005713.1-1861s1c1
Sequence:CCGGGCTGATAATGCAATCATCATTCTCGAGAATGATGATTGCATTATCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_005713.1-2200s1c1
Sequence:CCGGGCAAAGCGAGAGTATCCTAAACTCGAGTTTAGGATACTCTCGCTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005713.1-495s1c1
Sequence:CCGGCCTCAGTAAGTGGACAAACTACTCGAGTAGTTTGTCCACTTACTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_005713.1-1177s1c1
Sequence:CCGGGCAACACTTTCTCATTGTATTCTCGAGAATACAATGAGAAAGTGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005713
VALIDATED
COL4A3BP MISSION shRNA shRNA Plasmid DNA
collagen, type IV, alpha 3 (Goodpasture antigen) binding protein
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_005713.2-1923s21c1
Sequence:GTACCGGGCTTCTCAGCGAGACGTATTACTCGAGTAATACGTCTCGCTGAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315402    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005713.2-2498s21c1
Sequence:CCGGCTTGCTCAGCATATAACTATACTCGAGTATAGTTATATGCTGAGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_005713.2-1074s21c1
Sequence:CCGGCATAGTACCAACGGCAATAAACTCGAGTTTATTGCCGTTGGTACTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005713.2-1278s21c1
Sequence:CCGGAGAACAGAGGAAGCATATAAACTCGAGTTTATATGCTTCCTCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005713.2-1786s21c1
Sequence:CCGGGACATGAAGTCTGCAATTATTCTCGAGAATAATTGCAGACTTCATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005713.2-2214s21c1
Sequence:CCGGGCAAAGCGAGAGTATCCTAAACTCGAGTTTAGGATACTCTCGCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380482    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005713.2-2375s21c1
Sequence:GTACCGGAGCTGGAACGTAGGATCTATACTCGAGTATAGATCCTACGTTCCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005713.2-949s21c1
Sequence:GTACCGGACACGCTACAGAAGTACTTTGCTCGAGCAAAGTACTTCTGTAGCGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005713.2-1330s21c1
Sequence:GTACCGGACTTTGGAGGACCAGATTATGCTCGAGCATAATCTGGTCCTCCAAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005713.1-1861s1c1
Sequence:CCGGGCTGATAATGCAATCATCATTCTCGAGAATGATGATTGCATTATCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_005713.1-2200s1c1
Sequence:CCGGGCAAAGCGAGAGTATCCTAAACTCGAGTTTAGGATACTCTCGCTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005713.1-495s1c1
Sequence:CCGGCCTCAGTAAGTGGACAAACTACTCGAGTAGTTTGTCCACTTACTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_005713.1-1177s1c1
Sequence:CCGGGCAACACTTTCTCATTGTATTCTCGAGAATACAATGAGAAAGTGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005713
VALIDATED
COL4A3BP MISSION shRNA Lentiviral Transduction Particles
collagen, type IV, alpha 3 (Goodpasture antigen) binding protein
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_005713.2-1923s21c1
Sequence:GTACCGGGCTTCTCAGCGAGACGTATTACTCGAGTAATACGTCTCGCTGAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315402    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005713.2-2498s21c1
Sequence:CCGGCTTGCTCAGCATATAACTATACTCGAGTATAGTTATATGCTGAGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_005713.2-1074s21c1
Sequence:CCGGCATAGTACCAACGGCAATAAACTCGAGTTTATTGCCGTTGGTACTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005713.2-1278s21c1
Sequence:CCGGAGAACAGAGGAAGCATATAAACTCGAGTTTATATGCTTCCTCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005713.2-1786s21c1
Sequence:CCGGGACATGAAGTCTGCAATTATTCTCGAGAATAATTGCAGACTTCATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005713.2-2214s21c1
Sequence:CCGGGCAAAGCGAGAGTATCCTAAACTCGAGTTTAGGATACTCTCGCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380482    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005713.2-2375s21c1
Sequence:GTACCGGAGCTGGAACGTAGGATCTATACTCGAGTATAGATCCTACGTTCCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005713.2-949s21c1
Sequence:GTACCGGACACGCTACAGAAGTACTTTGCTCGAGCAAAGTACTTCTGTAGCGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005713.2-1330s21c1
Sequence:GTACCGGACTTTGGAGGACCAGATTATGCTCGAGCATAATCTGGTCCTCCAAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005713.1-1861s1c1
Sequence:CCGGGCTGATAATGCAATCATCATTCTCGAGAATGATGATTGCATTATCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_005713.1-2200s1c1
Sequence:CCGGGCAAAGCGAGAGTATCCTAAACTCGAGTTTAGGATACTCTCGCTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005713.1-495s1c1
Sequence:CCGGCCTCAGTAAGTGGACAAACTACTCGAGTAGTTTGTCCACTTACTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_005713.1-1177s1c1
Sequence:CCGGGCAACACTTTCTCATTGTATTCTCGAGAATACAATGAGAAAGTGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023420
VALIDATED
COL4A3BP MISSION shRNA Bacterial Glycerol Stock
collagen, type IV, alpha 3 (Goodpasture antigen) binding protein
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000379394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023420.2-1004s21c1
Sequence:CCGGATGAGCTTCAGAGGGATAAAGCTCGAGCTTTATCCCTCTGAAGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362460    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023420.2-2515s21c1
Sequence:CCGGTCACATGGATATGGCTATATTCTCGAGAATATAGCCATATCCATGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023420.2-1885s21c1
Sequence:CCGGGATAATGCAATCATCGTTTATCTCGAGATAAACGATGATTGCATTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079173    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023420.1-2430s1c1
Sequence:CCGGCCCAAGAAGAAACATTGCAATCTCGAGATTGCAATGTTTCTTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023420.1-1311s1c1
Sequence:CCGGGCGTACAAGAATGTGATGGAACTCGAGTTCCATCACATTCTTGTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023420.1-1094s1c1
Sequence:CCGGGCACAATACCAATGGTAATAACTCGAGTTATTACCATTGGTATTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023420.1-786s1c1
Sequence:CCGGCACAAGACTGAATCGGGATATCTCGAGATATCCCGATTCAGTCTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023420.1-695s1c1
Sequence:CCGGCCGGTTTGATATCAGTGTAAACTCGAGTTTACACTGATATCAAACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023420
VALIDATED
COL4A3BP MISSION shRNA shRNA Plasmid DNA
collagen, type IV, alpha 3 (Goodpasture antigen) binding protein
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000379394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023420.2-1004s21c1
Sequence:CCGGATGAGCTTCAGAGGGATAAAGCTCGAGCTTTATCCCTCTGAAGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362460    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023420.2-2515s21c1
Sequence:CCGGTCACATGGATATGGCTATATTCTCGAGAATATAGCCATATCCATGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023420.2-1885s21c1
Sequence:CCGGGATAATGCAATCATCGTTTATCTCGAGATAAACGATGATTGCATTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079173    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023420.1-2430s1c1
Sequence:CCGGCCCAAGAAGAAACATTGCAATCTCGAGATTGCAATGTTTCTTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023420.1-1311s1c1
Sequence:CCGGGCGTACAAGAATGTGATGGAACTCGAGTTCCATCACATTCTTGTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023420.1-1094s1c1
Sequence:CCGGGCACAATACCAATGGTAATAACTCGAGTTATTACCATTGGTATTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023420.1-786s1c1
Sequence:CCGGCACAAGACTGAATCGGGATATCTCGAGATATCCCGATTCAGTCTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023420.1-695s1c1
Sequence:CCGGCCGGTTTGATATCAGTGTAAACTCGAGTTTACACTGATATCAAACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023420
VALIDATED
COL4A3BP MISSION shRNA Lentiviral Transduction Particles
collagen, type IV, alpha 3 (Goodpasture antigen) binding protein
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000379394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023420.2-1004s21c1
Sequence:CCGGATGAGCTTCAGAGGGATAAAGCTCGAGCTTTATCCCTCTGAAGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362460    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023420.2-2515s21c1
Sequence:CCGGTCACATGGATATGGCTATATTCTCGAGAATATAGCCATATCCATGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023420.2-1885s21c1
Sequence:CCGGGATAATGCAATCATCGTTTATCTCGAGATAAACGATGATTGCATTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079173    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023420.1-2430s1c1
Sequence:CCGGCCCAAGAAGAAACATTGCAATCTCGAGATTGCAATGTTTCTTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023420.1-1311s1c1
Sequence:CCGGGCGTACAAGAATGTGATGGAACTCGAGTTCCATCACATTCTTGTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023420.1-1094s1c1
Sequence:CCGGGCACAATACCAATGGTAATAACTCGAGTTATTACCATTGGTATTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023420.1-786s1c1
Sequence:CCGGCACAAGACTGAATCGGGATATCTCGAGATATCCCGATTCAGTCTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023420.1-695s1c1
Sequence:CCGGCCGGTTTGATATCAGTGTAAACTCGAGTTTACACTGATATCAAACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks