EMAIL THIS PAGE TO A FRIEND

COL4A4

collagen, type IV, alpha 4

Synonyms: CA44
UniProtKB ID: P53420, A8MTZ1, Q53RW9, Q53S42, Q53WR1
Gene ID:
Human(1286) Summary: This gene encodes one of the six subunits of type IV collagen, the major structural component of basement membranes. This particular collagen IV subunit, however, is only found in a subset of basement membranes. Like the other members of the type IV collagen gene family, this gene is organized in a head-to-head conformation with another type IV collagen gene so that each gene pair shares a common promoter. Mutations in this gene are associated with type II autosomal recessive Alport syndrome (hereditary glomerulonephropathy) and with familial benign hematuria (thin basement membrane disease). Two transcripts, differing only in their transcription start sites, have been identified for this gene and, as is common for collagen genes, multiple polyadenylation sites are found in the 3' UTR. [provided by RefSeq, Jul 2008]
Mouse(12829) collagen, type IV, alpha 4
Rat(301562) collagen, type IV, alpha 4
Zebrafish(554270) collagen, type IV, alpha 4
cow(407107) collagen, type IV, alpha 4
Horse(100062160) collagen, type IV, alpha 4
domestic cat(101091469) collagen, type IV, alpha 4
dog(403841) collagen, type IV, alpha 4
chicken(424799) collagen, type IV, alpha 4
domestic guinea pig(100732595) collagen, type IV, alpha 4
naked mole-rat(101709839) collagen, type IV, alpha 4
sheep(101118172) collagen, type IV, alpha 4
183 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4500380 Anti-Collagen IV α4 antibody produced in rabbit affinity isolated antibody human
immunofluorescence, immunohistochemistry pricing
C1926 Monoclonal Anti-Collagen, Type IV antibody produced in mouse clone COL-94, ascites fluid human
dot blot, ELISA, immunohistochemistry, microarray pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000092 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000092 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000092 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007735 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007735 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007735 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000092 Rosetta Predictions human pricing
NM_001008332 Rosetta Predictions rat pricing
NM_007735 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000092 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00101026 predicted 2628
2 SASI_Hs01_00101028 predicted 775
3 SASI_Hs01_00101029 predicted 674
4 SASI_Hs01_00101030 predicted 4399
5 SASI_Hs01_00101032 predicted 776
6 SASI_Hs01_00101033 predicted 3510
7 SASI_Hs01_00101034 predicted 1343
8 SASI_Hs01_00101035 predicted 2006
9 SASI_Hs02_00301853 predicted 5256
10 SASI_Hs02_00301854 predicted 3151
11 SASI_Hs01_00101027 predicted 1173
12 SASI_Hs01_00101031 predicted 2550
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008332 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00083763 predicted 861
2 SASI_Rn01_00083764 predicted 243
3 SASI_Rn02_00199075 predicted 707
4 SASI_Rn01_00083765 predicted 580
5 SASI_Rn01_00083766 predicted 683
6 SASI_Rn01_00083767 predicted 254
7 SASI_Rn01_00083768 predicted 501
8 SASI_Rn01_00083769 predicted 864
9 SASI_Rn01_00083770 predicted 316
10 SASI_Rn01_00083771 predicted 322
11 SASI_Rn01_00083762 predicted 720
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007735 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00039558 predicted 853
2 SASI_Mm01_00039559 predicted 408
3 SASI_Mm01_00039560 predicted 862
4 SASI_Mm01_00039561 predicted 1463
5 SASI_Mm01_00039562 predicted 4287
6 SASI_Mm01_00039563 predicted 2474
7 SASI_Mm01_00039564 predicted 1456
8 SASI_Mm01_00039565 predicted 4356
9 SASI_Mm01_00039566 predicted 3436
10 SASI_Mm01_00039567 predicted 1013
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000092
COL4A4 MISSION shRNA Bacterial Glycerol Stock
collagen, type IV, alpha 4
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000117182    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000092.3-7140s1c1
Sequence:CCGGGCTAGGAATTTGGTGATCTAACTCGAGTTAGATCACCAAATTCCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000092.3-2901s1c1
Sequence:CCGGCCAGGAGTGAATGGTCAGAAACTCGAGTTTCTGACCATTCACTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000092.3-720s1c1
Sequence:CCGGCCCTGGTCACTTATACTCATTCTCGAGAATGAGTATAAGTGACCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000092.3-1617s1c1
Sequence:CCGGCCAGGATTAAAGGGAGAACTACTCGAGTAGTTCTCCCTTTAATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000092.3-2009s1c1
Sequence:CCGGCCCAGGATCAAGTGTGATATACTCGAGTATATCACACTTGATCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000092.4-5720s21c1
Sequence:CCGGATAGCTAGAGAATGCGAAATTCTCGAGAATTTCGCATTCTCTAGCTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000092.4-1646s21c1
Sequence:CCGGTTGGAGATCCTGGGCTATTTGCTCGAGCAAATAGCCCAGGATCTCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000092
COL4A4 MISSION shRNA shRNA Plasmid DNA
collagen, type IV, alpha 4
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000117182    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000092.3-7140s1c1
Sequence:CCGGGCTAGGAATTTGGTGATCTAACTCGAGTTAGATCACCAAATTCCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000092.3-2901s1c1
Sequence:CCGGCCAGGAGTGAATGGTCAGAAACTCGAGTTTCTGACCATTCACTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000092.3-720s1c1
Sequence:CCGGCCCTGGTCACTTATACTCATTCTCGAGAATGAGTATAAGTGACCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000092.3-1617s1c1
Sequence:CCGGCCAGGATTAAAGGGAGAACTACTCGAGTAGTTCTCCCTTTAATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000092.3-2009s1c1
Sequence:CCGGCCCAGGATCAAGTGTGATATACTCGAGTATATCACACTTGATCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000092.4-5720s21c1
Sequence:CCGGATAGCTAGAGAATGCGAAATTCTCGAGAATTTCGCATTCTCTAGCTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000092.4-1646s21c1
Sequence:CCGGTTGGAGATCCTGGGCTATTTGCTCGAGCAAATAGCCCAGGATCTCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000092
COL4A4 MISSION shRNA Lentiviral Transduction Particles
collagen, type IV, alpha 4
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000117182    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000092.3-7140s1c1
Sequence:CCGGGCTAGGAATTTGGTGATCTAACTCGAGTTAGATCACCAAATTCCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000092.3-2901s1c1
Sequence:CCGGCCAGGAGTGAATGGTCAGAAACTCGAGTTTCTGACCATTCACTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000092.3-720s1c1
Sequence:CCGGCCCTGGTCACTTATACTCATTCTCGAGAATGAGTATAAGTGACCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000092.3-1617s1c1
Sequence:CCGGCCAGGATTAAAGGGAGAACTACTCGAGTAGTTCTCCCTTTAATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000092.3-2009s1c1
Sequence:CCGGCCCAGGATCAAGTGTGATATACTCGAGTATATCACACTTGATCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000092.4-5720s21c1
Sequence:CCGGATAGCTAGAGAATGCGAAATTCTCGAGAATTTCGCATTCTCTAGCTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000092.4-1646s21c1
Sequence:CCGGTTGGAGATCCTGGGCTATTTGCTCGAGCAAATAGCCCAGGATCTCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007735
COL4A4 MISSION shRNA Bacterial Glycerol Stock
collagen, type IV, alpha 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000091803    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007735.1-5654s1c1
Sequence:CCGGCGGATGACAAAGACCAGATTACTCGAGTAATCTGGTCTTTGTCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007735.1-2605s1c1
Sequence:CCGGCCAGGCATGAAAGGACAGAAACTCGAGTTTCTGTCCTTTCATGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007735.1-1792s1c1
Sequence:CCGGCCTGGAAGACAAGGAAGTAAACTCGAGTTTACTTCCTTGTCTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007735.1-1053s1c1
Sequence:CCGGGCCGCCTGATTTGAGTATCTACTCGAGTAGATACTCAAATCAGGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007735.1-1056s1c1
Sequence:CCGGGCCTGATTTGAGTATCTATAACTCGAGTTATAGATACTCAAATCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007735
COL4A4 MISSION shRNA shRNA Plasmid DNA
collagen, type IV, alpha 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000091803    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007735.1-5654s1c1
Sequence:CCGGCGGATGACAAAGACCAGATTACTCGAGTAATCTGGTCTTTGTCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007735.1-2605s1c1
Sequence:CCGGCCAGGCATGAAAGGACAGAAACTCGAGTTTCTGTCCTTTCATGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007735.1-1792s1c1
Sequence:CCGGCCTGGAAGACAAGGAAGTAAACTCGAGTTTACTTCCTTGTCTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007735.1-1053s1c1
Sequence:CCGGGCCGCCTGATTTGAGTATCTACTCGAGTAGATACTCAAATCAGGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007735.1-1056s1c1
Sequence:CCGGGCCTGATTTGAGTATCTATAACTCGAGTTATAGATACTCAAATCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007735
COL4A4 MISSION shRNA Lentiviral Transduction Particles
collagen, type IV, alpha 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000091803    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007735.1-5654s1c1
Sequence:CCGGCGGATGACAAAGACCAGATTACTCGAGTAATCTGGTCTTTGTCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007735.1-2605s1c1
Sequence:CCGGCCAGGCATGAAAGGACAGAAACTCGAGTTTCTGTCCTTTCATGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007735.1-1792s1c1
Sequence:CCGGCCTGGAAGACAAGGAAGTAAACTCGAGTTTACTTCCTTGTCTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007735.1-1053s1c1
Sequence:CCGGGCCGCCTGATTTGAGTATCTACTCGAGTAGATACTCAAATCAGGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007735.1-1056s1c1
Sequence:CCGGGCCTGATTTGAGTATCTATAACTCGAGTTATAGATACTCAAATCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks