EMAIL THIS PAGE TO A FRIEND

COL4A5

collagen, type IV, alpha 5

148 Gene Product Result for
Synonyms: ASLN ATS CA54
UniProtKB ID: P29400, Q16006, Q16126, Q6LD84, Q7Z700, Q9NUB7
Gene ID:
Human(1287) Summary: This gene encodes one of the six subunits of type IV collagen, the major structural component of basement membranes. Mutations in this gene are associated with X-linked Alport syndrome, also known as hereditary nephritis. Like the other members of the type IV collagen gene family, this gene is organized in a head-to-head conformation with another type IV collagen gene so that each gene pair shares a common promoter. Alternatively spliced transcript variants have been identified for this gene. [provided by RefSeq, Aug 2010]
Mouse(12830) collagen, type IV, alpha 5
Rat(363457) collagen, type IV, alpha 5
sheep(101112706) collagen, type IV, alpha 5
naked mole-rat(101709338) collagen, type IV, alpha 5
domestic guinea pig(100717641) collagen, type IV, alpha 5
Zebrafish(323561) collagen, type IV, alpha 5 (Alport syndrome)
dog(403466) collagen, type IV, alpha 5
chicken(422348) collagen, type IV, alpha 5
cow(511602) collagen, type IV, alpha 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007736 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007736 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007736 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000495 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000495 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000495 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU085261 MISSION® esiRNA esiRNA human COL4A5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000495 Rosetta Predictions human pricing
NM_033380 Rosetta Predictions human pricing
NM_033381 Rosetta Predictions human pricing
XM_001055156 Rosetta Predictions rat pricing
XM_343778 Rosetta Predictions rat pricing
NM_007736 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000495 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00302655 predicted 1248
2 SASI_Hs01_00172707 predicted 2685
3 SASI_Hs01_00172708 predicted 4612
4 SASI_Hs01_00172709 predicted 3386
5 SASI_Hs01_00172710 predicted 1517
6 SASI_Hs01_00172711 predicted 4430
7 SASI_Hs01_00172712 predicted 939
8 SASI_Hs01_00172713 predicted 4730
9 SASI_Hs02_00302656 predicted 4775
10 SASI_Hs01_00172715 predicted 4988
11 SASI_Hs01_00172706 predicted 696
12 SASI_Hs01_00172714 predicted 4781
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033380 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00361235 predicted 1251
2 SASI_Hs01_00126685 predicted 2689
3 SASI_Hs01_00126686 predicted 4636
4 SASI_Hs01_00126687 predicted 3389
5 SASI_Hs01_00126688 predicted 1523
6 SASI_Hs01_00126689 predicted 4449
7 SASI_Hs01_00126690 predicted 938
8 SASI_Hs01_00126691 predicted 4751
9 SASI_Hs02_00361236 predicted 4788
10 SASI_Hs01_00126693 predicted 5002
11 SASI_Hs01_00126684 predicted 696
12 SASI_Hs01_00126692 predicted 4804
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033381 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00361237 predicted 1246
2 SASI_Hs01_00104052 predicted 2689
3 SASI_Hs01_00104053 predicted 4629
4 SASI_Hs01_00104054 predicted 3392
5 SASI_Hs01_00104055 predicted 1518
6 SASI_Hs01_00104056 predicted 4438
7 SASI_Hs01_00104057 predicted 943
8 SASI_Hs01_00104058 predicted 4743
9 SASI_Hs02_00361238 predicted 4784
10 SASI_Hs01_00104060 predicted 4995
11 SASI_Hs01_00104051 predicted 695
12 SASI_Hs01_00104059 predicted 4793
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055156 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00278654 predicted 2368
2 SASI_Rn02_00278655 predicted 4807
3 SASI_Rn02_00278656 predicted 1471
4 SASI_Rn02_00278657 predicted 1780
5 SASI_Rn02_00278658 predicted 2002
6 SASI_Rn02_00278659 predicted 836
7 SASI_Rn02_00278660 predicted 4803
8 SASI_Rn02_00278661 predicted 509
9 SASI_Rn02_00278662 predicted 5090
10 SASI_Rn02_00278663 predicted 4777
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343778 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00396299 predicted 2366
2 SASI_Rn02_00396300 predicted 4809
3 SASI_Rn02_00396301 predicted 1467
4 SASI_Rn02_00396302 predicted 1777
5 SASI_Rn02_00396303 predicted 1997
6 SASI_Rn02_00396304 predicted 836
7 SASI_Rn02_00396305 predicted 4809
8 SASI_Rn02_00396306 predicted 506
9 SASI_Rn02_00396307 predicted 5095
10 SASI_Rn02_00396308 predicted 4774
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007736 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00172212 predicted 883
2 SASI_Mm01_00172213 predicted 1571
3 SASI_Mm01_00172214 predicted 1254
4 SASI_Mm01_00172217 predicted 3089
5 SASI_Mm02_00312331 predicted 4709
6 SASI_Mm01_00172218 predicted 4386
7 SASI_Mm01_00172219 predicted 3045
8 SASI_Mm01_00172220 predicted 4877
9 SASI_Mm01_00172221 predicted 4736
10 SASI_Mm02_00312332 predicted 4549
11 SASI_Mm01_00172215 predicted 4629
12 SASI_Mm01_00172216 predicted 1697
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007736
COL4A5 MISSION shRNA Bacterial Glycerol Stock
collagen, type IV, alpha 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000090472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007736.1-2014s1c1
Sequence:CCGGCCAGGAAATATGGGACCTACACTCGAGTGTAGGTCCCATATTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090468    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007736.1-5467s1c1
Sequence:CCGGGCTCCATCCTTCCTTATGAAACTCGAGTTTCATAAGGAAGGATGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007736.1-4740s1c1
Sequence:CCGGGCCTTTCATGTTCTGCAACATCTCGAGATGTTGCAGAACATGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007736.1-4131s1c1
Sequence:CCGGGCCAGGTCTTAATGGAATGAACTCGAGTTCATTCCATTAAGACCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007736.1-1558s1c1
Sequence:CCGGCCAGGTGATAAAGGACTCCAACTCGAGTTGGAGTCCTTTATCACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007736
COL4A5 MISSION shRNA shRNA Plasmid DNA
collagen, type IV, alpha 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000090472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007736.1-2014s1c1
Sequence:CCGGCCAGGAAATATGGGACCTACACTCGAGTGTAGGTCCCATATTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090468    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007736.1-5467s1c1
Sequence:CCGGGCTCCATCCTTCCTTATGAAACTCGAGTTTCATAAGGAAGGATGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007736.1-4740s1c1
Sequence:CCGGGCCTTTCATGTTCTGCAACATCTCGAGATGTTGCAGAACATGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007736.1-4131s1c1
Sequence:CCGGGCCAGGTCTTAATGGAATGAACTCGAGTTCATTCCATTAAGACCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007736.1-1558s1c1
Sequence:CCGGCCAGGTGATAAAGGACTCCAACTCGAGTTGGAGTCCTTTATCACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007736
COL4A5 MISSION shRNA Lentiviral Transduction Particles
collagen, type IV, alpha 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000090472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007736.1-2014s1c1
Sequence:CCGGCCAGGAAATATGGGACCTACACTCGAGTGTAGGTCCCATATTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090468    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007736.1-5467s1c1
Sequence:CCGGGCTCCATCCTTCCTTATGAAACTCGAGTTTCATAAGGAAGGATGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007736.1-4740s1c1
Sequence:CCGGGCCTTTCATGTTCTGCAACATCTCGAGATGTTGCAGAACATGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007736.1-4131s1c1
Sequence:CCGGGCCAGGTCTTAATGGAATGAACTCGAGTTCATTCCATTAAGACCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007736.1-1558s1c1
Sequence:CCGGCCAGGTGATAAAGGACTCCAACTCGAGTTGGAGTCCTTTATCACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000495
COL4A5 MISSION shRNA Bacterial Glycerol Stock
collagen, type IV, alpha 5
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000082833    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000495.3-5439s1c1
Sequence:CCGGGCCAGAGCAAAGTCTCTATTACTCGAGTAATAGAGACTTTGCTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000495.3-4025s1c1
Sequence:CCGGCCTGGAAATGGAGGTATTAAACTCGAGTTTAATACCTCCATTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000495.3-2495s1c1
Sequence:CCGGCCAGGTTTCAAAGGAGCACTTCTCGAGAAGTGCTCCTTTGAAACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000495.3-1775s1c1
Sequence:CCGGCCCAAAGGATTACCAGGCATTCTCGAGAATGCCTGGTAATCCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000495.3-5081s1c1
Sequence:CCGGGCTCCCTTCATCGAATGTCATCTCGAGATGACATTCGATGAAGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000495
COL4A5 MISSION shRNA shRNA Plasmid DNA
collagen, type IV, alpha 5
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000082833    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000495.3-5439s1c1
Sequence:CCGGGCCAGAGCAAAGTCTCTATTACTCGAGTAATAGAGACTTTGCTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000495.3-4025s1c1
Sequence:CCGGCCTGGAAATGGAGGTATTAAACTCGAGTTTAATACCTCCATTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000495.3-2495s1c1
Sequence:CCGGCCAGGTTTCAAAGGAGCACTTCTCGAGAAGTGCTCCTTTGAAACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000495.3-1775s1c1
Sequence:CCGGCCCAAAGGATTACCAGGCATTCTCGAGAATGCCTGGTAATCCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000495.3-5081s1c1
Sequence:CCGGGCTCCCTTCATCGAATGTCATCTCGAGATGACATTCGATGAAGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000495
COL4A5 MISSION shRNA Lentiviral Transduction Particles
collagen, type IV, alpha 5
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000082833    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000495.3-5439s1c1
Sequence:CCGGGCCAGAGCAAAGTCTCTATTACTCGAGTAATAGAGACTTTGCTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000495.3-4025s1c1
Sequence:CCGGCCTGGAAATGGAGGTATTAAACTCGAGTTTAATACCTCCATTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000495.3-2495s1c1
Sequence:CCGGCCAGGTTTCAAAGGAGCACTTCTCGAGAAGTGCTCCTTTGAAACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000495.3-1775s1c1
Sequence:CCGGCCCAAAGGATTACCAGGCATTCTCGAGAATGCCTGGTAATCCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000495.3-5081s1c1
Sequence:CCGGGCTCCCTTCATCGAATGTCATCTCGAGATGACATTCGATGAAGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks