EMAIL THIS PAGE TO A FRIEND

COL4A6

collagen, type IV, alpha 6

179 Gene Product Result for
Synonyms: CXDELq22.3 DELXq22.3
Gene ID:
Human(1288) Summary: This gene encodes one of the six subunits of type IV collagen, the major structural component of basement membranes. Like the other members of the type IV collagen gene family, this gene is organized in a head-to-head conformation with another type IV collagen gene, alpha 5 type IV collagen, so that the gene pair shares a common promoter. Deletions in the alpha 5 gene that extend into the alpha 6 gene result in diffuse leiomyomatosis accompanying the X-linked Alport syndrome caused by the deletion in the alpha 5 gene. Two splice variants have been identified for this gene. [provided by RefSeq, Jul 2008]
Mouse(94216) collagen, type IV, alpha 6
Rat(363458) collagen, type IV, alpha 6
Zebrafish(554268) collagen, type IV, alpha 6
chicken(422350) collagen, type IV, alpha 6
cow(523526) collagen, type IV, alpha 6
domestic cat(101089498) collagen, type IV, alpha 6
dog(403840) collagen, type IV, alpha 6
domestic guinea pig(100718202) collagen, type IV, alpha 6
naked mole-rat(101710396) collagen, type IV, alpha 6
sheep(101113128) collagen, type IV, alpha 6
Domestic Rabbit(100338437) collagen, type IV, alpha 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_053185 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053185 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053185 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001847 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001847 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001847 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001847 Rosetta Predictions human pricing
NM_033641 Rosetta Predictions human pricing
XM_001056684 Rosetta Predictions rat pricing
XM_001061199 Rosetta Predictions rat pricing
NM_053185 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001847 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00241176 predicted 2717
2 SASI_Hs01_00241177 predicted 1071
3 SASI_Hs01_00241178 predicted 3573
4 SASI_Hs01_00241179 predicted 1737
5 SASI_Hs01_00241180 predicted 4980
6 SASI_Hs01_00241181 predicted 2558
7 SASI_Hs01_00241182 predicted 3554
8 SASI_Hs01_00241183 predicted 1327
9 SASI_Hs02_00332661 predicted 4307
10 SASI_Hs01_00241184 predicted 2956
11 SASI_Hs01_00241185 predicted 839
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033641 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00172273 predicted 2842
2 SASI_Hs01_00172274 predicted 1195
3 SASI_Hs01_00172275 predicted 3699
4 SASI_Hs01_00172276 predicted 1860
5 SASI_Hs01_00172277 predicted 5100
6 SASI_Hs01_00172278 predicted 2681
7 SASI_Hs01_00172279 predicted 3679
8 SASI_Hs01_00172280 predicted 1457
9 SASI_Hs02_00361453 predicted 4432
10 SASI_Hs01_00172281 predicted 3084
11 SASI_Hs01_00172282 predicted 963
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001056684 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00284042 predicted 1835
2 SASI_Rn02_00284043 predicted 611
3 SASI_Rn02_00284044 predicted 4753
4 SASI_Rn02_00284045 predicted 4933
5 SASI_Rn02_00284046 predicted 2346
6 SASI_Rn02_00284047 predicted 2103
7 SASI_Rn02_00284048 predicted 2787
8 SASI_Rn02_00284049 predicted 1753
9 SASI_Rn02_00284050 predicted 5038
10 SASI_Rn02_00284051 predicted 978
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001061199 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00299125 predicted 1314
2 SASI_Rn02_00299126 predicted 244
3 SASI_Rn02_00299127 predicted 3849
4 SASI_Rn02_00299128 predicted 1818
5 SASI_Rn02_00299129 predicted 1574
6 SASI_Rn02_00299130 predicted 2656
7 SASI_Rn02_00299131 predicted 1229
8 SASI_Rn02_00299132 predicted 562
9 SASI_Rn02_00299133 predicted 993
10 SASI_Rn02_00299134 predicted 2814
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053185 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00147472 predicted 841
2 SASI_Mm01_00147473 predicted 3272
3 SASI_Mm01_00147474 predicted 4152
4 SASI_Mm01_00147475 predicted 1844
5 SASI_Mm02_00337744 predicted 4762
6 SASI_Mm01_00147477 predicted 5051
7 SASI_Mm01_00147478 predicted 1752
8 SASI_Mm01_00147480 predicted 2707
9 SASI_Mm01_00147481 predicted 993
10 SASI_Mm02_00337745 predicted 3462
11 SASI_Mm01_00147476 predicted 3922
12 SASI_Mm01_00147479 predicted 4855
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053185
COL4A6 MISSION shRNA Bacterial Glycerol Stock
collagen, type IV, alpha 6
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000090583    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053185.1-5687s1c1
Sequence:CCGGCCACACATCATTTGAGTCAAACTCGAGTTTGACTCAAATGATGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053185.1-2154s1c1
Sequence:CCGGCCTGGAGATAAAGGAGTAGATCTCGAGATCTACTCCTTTATCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053185.1-3891s1c1
Sequence:CCGGCCAGGAATTGTCATCGGAGATCTCGAGATCTCCGATGACAATTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053185.1-2967s1c1
Sequence:CCGGCCAGTAGGATTTCCTGGGTTACTCGAGTAACCCAGGAAATCCTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053185.1-4823s1c1
Sequence:CCGGGCCCTTCATATACTGCAACATCTCGAGATGTTGCAGTATATGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053185.2-3891s21c1
Sequence:CCGGCCAGGAATTGTCATCGGAGATCTCGAGATCTCCGATGACAATTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053185.2-4823s21c1
Sequence:CCGGGCCCTTCATATACTGCAACATCTCGAGATGTTGCAGTATATGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352279    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053185.2-5689s21c1
Sequence:CCGGCCACACATCATTTGAGTCAAACTCGAGTTTGACTCAAATGATGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053185.2-2154s21c1
Sequence:CCGGCCTGGAGATAAAGGAGTAGATCTCGAGATCTACTCCTTTATCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053185
COL4A6 MISSION shRNA shRNA Plasmid DNA
collagen, type IV, alpha 6
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000090583    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053185.1-5687s1c1
Sequence:CCGGCCACACATCATTTGAGTCAAACTCGAGTTTGACTCAAATGATGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053185.1-2154s1c1
Sequence:CCGGCCTGGAGATAAAGGAGTAGATCTCGAGATCTACTCCTTTATCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053185.1-3891s1c1
Sequence:CCGGCCAGGAATTGTCATCGGAGATCTCGAGATCTCCGATGACAATTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053185.1-2967s1c1
Sequence:CCGGCCAGTAGGATTTCCTGGGTTACTCGAGTAACCCAGGAAATCCTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053185.1-4823s1c1
Sequence:CCGGGCCCTTCATATACTGCAACATCTCGAGATGTTGCAGTATATGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053185.2-3891s21c1
Sequence:CCGGCCAGGAATTGTCATCGGAGATCTCGAGATCTCCGATGACAATTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053185.2-4823s21c1
Sequence:CCGGGCCCTTCATATACTGCAACATCTCGAGATGTTGCAGTATATGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352279    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053185.2-5689s21c1
Sequence:CCGGCCACACATCATTTGAGTCAAACTCGAGTTTGACTCAAATGATGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053185.2-2154s21c1
Sequence:CCGGCCTGGAGATAAAGGAGTAGATCTCGAGATCTACTCCTTTATCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053185
COL4A6 MISSION shRNA Lentiviral Transduction Particles
collagen, type IV, alpha 6
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000090583    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053185.1-5687s1c1
Sequence:CCGGCCACACATCATTTGAGTCAAACTCGAGTTTGACTCAAATGATGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053185.1-2154s1c1
Sequence:CCGGCCTGGAGATAAAGGAGTAGATCTCGAGATCTACTCCTTTATCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053185.1-3891s1c1
Sequence:CCGGCCAGGAATTGTCATCGGAGATCTCGAGATCTCCGATGACAATTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053185.1-2967s1c1
Sequence:CCGGCCAGTAGGATTTCCTGGGTTACTCGAGTAACCCAGGAAATCCTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053185.1-4823s1c1
Sequence:CCGGGCCCTTCATATACTGCAACATCTCGAGATGTTGCAGTATATGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053185.2-3891s21c1
Sequence:CCGGCCAGGAATTGTCATCGGAGATCTCGAGATCTCCGATGACAATTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053185.2-4823s21c1
Sequence:CCGGGCCCTTCATATACTGCAACATCTCGAGATGTTGCAGTATATGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352279    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053185.2-5689s21c1
Sequence:CCGGCCACACATCATTTGAGTCAAACTCGAGTTTGACTCAAATGATGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053185.2-2154s21c1
Sequence:CCGGCCTGGAGATAAAGGAGTAGATCTCGAGATCTACTCCTTTATCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001847
VALIDATED
COL4A6 MISSION shRNA Bacterial Glycerol Stock
collagen, type IV, alpha 6
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000084134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_001847.1-3621s1c1
Sequence:CCGGCCTGGTTTACATGGACTGAATCTCGAGATTCAGTCCATGTAAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_001847.1-5109s1c1
Sequence:CCGGCCTGTGTCTGAAACGCTGAAACTCGAGTTTCAGCGTTTCAGACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001847.1-2077s1c1
Sequence:CCGGCCTGTATTATTCCTGGGTCATCTCGAGATGACCCAGGAATAATACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084133    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_001847.1-5949s1c1
Sequence:CCGGGCCAAGCCTATCAAAGGAAATCTCGAGATTTCCTTTGATAGGCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286963    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001847.2-5938s21c1
Sequence:CCGGGCCAAGCCTATCAAAGGAAATCTCGAGATTTCCTTTGATAGGCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001847.2-3614s21c1
Sequence:CCGGCCTGGTTTACATGGACTGAATCTCGAGATTCAGTCCATGTAAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001847.2-5102s21c1
Sequence:CCGGCCTGTGTCTGAAACGCTGAAACTCGAGTTTCAGCGTTTCAGACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001847.2-3399s21c1
Sequence:CCGGATGGACTAATAGGCAATATAGCTCGAGCTATATTGCCTATTAGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001847.2-4705s21c1
Sequence:CCGGCTATGCCAGGCGCAATGATAACTCGAGTTATCATTGCGCCTGGCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001847
VALIDATED
COL4A6 MISSION shRNA shRNA Plasmid DNA
collagen, type IV, alpha 6
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000084134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_001847.1-3621s1c1
Sequence:CCGGCCTGGTTTACATGGACTGAATCTCGAGATTCAGTCCATGTAAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_001847.1-5109s1c1
Sequence:CCGGCCTGTGTCTGAAACGCTGAAACTCGAGTTTCAGCGTTTCAGACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001847.1-2077s1c1
Sequence:CCGGCCTGTATTATTCCTGGGTCATCTCGAGATGACCCAGGAATAATACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084133    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_001847.1-5949s1c1
Sequence:CCGGGCCAAGCCTATCAAAGGAAATCTCGAGATTTCCTTTGATAGGCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286963    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001847.2-5938s21c1
Sequence:CCGGGCCAAGCCTATCAAAGGAAATCTCGAGATTTCCTTTGATAGGCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001847.2-3614s21c1
Sequence:CCGGCCTGGTTTACATGGACTGAATCTCGAGATTCAGTCCATGTAAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001847.2-5102s21c1
Sequence:CCGGCCTGTGTCTGAAACGCTGAAACTCGAGTTTCAGCGTTTCAGACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001847.2-3399s21c1
Sequence:CCGGATGGACTAATAGGCAATATAGCTCGAGCTATATTGCCTATTAGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001847.2-4705s21c1
Sequence:CCGGCTATGCCAGGCGCAATGATAACTCGAGTTATCATTGCGCCTGGCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001847
VALIDATED
COL4A6 MISSION shRNA Lentiviral Transduction Particles
collagen, type IV, alpha 6
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000084134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_001847.1-3621s1c1
Sequence:CCGGCCTGGTTTACATGGACTGAATCTCGAGATTCAGTCCATGTAAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_001847.1-5109s1c1
Sequence:CCGGCCTGTGTCTGAAACGCTGAAACTCGAGTTTCAGCGTTTCAGACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001847.1-2077s1c1
Sequence:CCGGCCTGTATTATTCCTGGGTCATCTCGAGATGACCCAGGAATAATACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084133    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_001847.1-5949s1c1
Sequence:CCGGGCCAAGCCTATCAAAGGAAATCTCGAGATTTCCTTTGATAGGCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286963    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001847.2-5938s21c1
Sequence:CCGGGCCAAGCCTATCAAAGGAAATCTCGAGATTTCCTTTGATAGGCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001847.2-3614s21c1
Sequence:CCGGCCTGGTTTACATGGACTGAATCTCGAGATTCAGTCCATGTAAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001847.2-5102s21c1
Sequence:CCGGCCTGTGTCTGAAACGCTGAAACTCGAGTTTCAGCGTTTCAGACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001847.2-3399s21c1
Sequence:CCGGATGGACTAATAGGCAATATAGCTCGAGCTATATTGCCTATTAGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001847.2-4705s21c1
Sequence:CCGGCTATGCCAGGCGCAATGATAACTCGAGTTATCATTGCGCCTGGCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks