EMAIL THIS PAGE TO A FRIEND

COL5A1

collagen, type V, alpha 1

UniProtKB ID: P20908, Q15094, Q5SUX4
Gene ID:
Human(1289) Summary: This gene encodes an alpha chain for one of the low abundance fibrillar collagens. Fibrillar collagen molecules are trimers that can be composed of one or more types of alpha chains. Type V collagen is found in tissues containing type I collagen and appears to regulate the assembly of heterotypic fibers composed of both type I and type V collagen. This gene product is closely related to type XI collagen and it is possible that the collagen chains of types V and XI constitute a single collagen type with tissue-specific chain combinations. The encoded procollagen protein occurs commonly as the heterotrimer pro-alpha1(V)-pro-alpha1(V)-pro-alpha2(V). Mutations in this gene are associated with Ehlers-Danlos syndrome, types I and II. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2013]
Mouse(12831) collagen, type V, alpha 1
Rat(85490) collagen, type V, alpha 1
Zebrafish(100334431) procollagen, type V, alpha 1
dog(480684) collagen, type V, alpha 1
cow(537387) collagen, type V, alpha 1
chicken(395568) collagen, type V, alpha 1
sheep(101107777) collagen, type V, alpha 1
Domestic Rabbit(100327268) collagen, type V, alpha 1
naked mole-rat(101724307) collagen, type V, alpha 1
domestic guinea pig(100724382) collagen, type V, alpha 1
111 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000093 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000093 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000093 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_015734 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_015734 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_015734 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000093 Rosetta Predictions human pricing
NM_134452 Rosetta Predictions rat pricing
NM_015734 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000093 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00168373 predicted 5821
2 SASI_Hs01_00168374 predicted 872
3 SASI_Hs01_00168375 predicted 1424
4 SASI_Hs01_00168377 predicted 1693
5 SASI_Hs01_00168378 predicted 5846
6 SASI_Hs01_00168379 predicted 1076
7 SASI_Hs01_00168380 predicted 5452
8 SASI_Hs01_00168381 predicted 1071
9 SASI_Hs02_00301855 predicted 2788
10 SASI_Hs02_00301856 predicted 2990
11 SASI_Hs01_00168376 predicted 5374
12 SASI_Hs01_00168382 predicted 5751
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134452 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00110334 predicted 808
2 SASI_Rn02_00268032 predicted 1214
3 SASI_Rn01_00110336 predicted 1046
4 SASI_Rn01_00110337 predicted 812
5 SASI_Rn01_00110338 predicted 1384
6 SASI_Rn02_00268033 predicted 825
7 SASI_Rn01_00110339 predicted 218
8 SASI_Rn01_00110341 predicted 586
9 SASI_Rn01_00110342 predicted 1240
10 SASI_Rn01_00110343 predicted 456
11 SASI_Rn01_00110335 predicted 3703
12 SASI_Rn01_00110340 predicted 2305
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015734 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00135121 predicted 2630
2 SASI_Mm01_00135122 predicted 1190
3 SASI_Mm01_00135123 predicted 5703
4 SASI_Mm01_00135124 predicted 1167
5 SASI_Mm01_00135125 predicted 5677
6 SASI_Mm01_00135126 predicted 1616
7 SASI_Mm01_00135127 predicted 5852
8 SASI_Mm02_00323060 predicted 929
9 SASI_Mm01_00135128 predicted 5841
10 SASI_Mm01_00135129 predicted 4026
11 SASI_Mm01_00135120 predicted 246
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000093
COL5A1 MISSION shRNA Bacterial Glycerol Stock
collagen, type V, alpha 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000415024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000093.3-1689s21c1
Sequence:CCGGCGAACCAGGATACCATCTATGCTCGAGCATAGATGGTATCCTGGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082808    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000093.2-6265s1c1
Sequence:CCGGCCAGATTTGGACACTATATTTCTCGAGAAATATAGTGTCCAAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000093.2-3030s1c1
Sequence:CCGGGCTCTATTGGATTCCCTGGATCTCGAGATCCAGGGAATCCAATAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000093.2-1433s1c1
Sequence:CCGGCCGTATGATGACCTCACCTATCTCGAGATAGGTGAGGTCATCATACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000093.2-1192s1c1
Sequence:CCGGTGAGACCTATTACTACGAATACTCGAGTATTCGTAGTAATAGGTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000093.2-1186s1c1
Sequence:CCGGCGAGGGTGAGACCTATTACTACTCGAGTAGTAATAGGTCTCACCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000093
COL5A1 MISSION shRNA shRNA Plasmid DNA
collagen, type V, alpha 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000415024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000093.3-1689s21c1
Sequence:CCGGCGAACCAGGATACCATCTATGCTCGAGCATAGATGGTATCCTGGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082808    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000093.2-6265s1c1
Sequence:CCGGCCAGATTTGGACACTATATTTCTCGAGAAATATAGTGTCCAAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000093.2-3030s1c1
Sequence:CCGGGCTCTATTGGATTCCCTGGATCTCGAGATCCAGGGAATCCAATAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000093.2-1433s1c1
Sequence:CCGGCCGTATGATGACCTCACCTATCTCGAGATAGGTGAGGTCATCATACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000093.2-1192s1c1
Sequence:CCGGTGAGACCTATTACTACGAATACTCGAGTATTCGTAGTAATAGGTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000093.2-1186s1c1
Sequence:CCGGCGAGGGTGAGACCTATTACTACTCGAGTAGTAATAGGTCTCACCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000093
COL5A1 MISSION shRNA Lentiviral Transduction Particles
collagen, type V, alpha 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000415024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000093.3-1689s21c1
Sequence:CCGGCGAACCAGGATACCATCTATGCTCGAGCATAGATGGTATCCTGGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082808    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000093.2-6265s1c1
Sequence:CCGGCCAGATTTGGACACTATATTTCTCGAGAAATATAGTGTCCAAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000093.2-3030s1c1
Sequence:CCGGGCTCTATTGGATTCCCTGGATCTCGAGATCCAGGGAATCCAATAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000093.2-1433s1c1
Sequence:CCGGCCGTATGATGACCTCACCTATCTCGAGATAGGTGAGGTCATCATACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000093.2-1192s1c1
Sequence:CCGGTGAGACCTATTACTACGAATACTCGAGTATTCGTAGTAATAGGTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000093.2-1186s1c1
Sequence:CCGGCGAGGGTGAGACCTATTACTACTCGAGTAGTAATAGGTCTCACCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015734
VALIDATED
COL5A1 MISSION shRNA Bacterial Glycerol Stock
collagen, type V, alpha 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000313467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_015734.2-1623s21c1
Sequence:CCGGACTACTATGACCCGTACTTTGCTCGAGCAAAGTACGGGTCATAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313468    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_015734.2-6374s21c1
Sequence:CCGGACGTGCCTTTCCGATGGATTACTCGAGTAATCCATCGGAAAGGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_015734.2-1186s21c1
Sequence:CCGGAGGAGAGGGTGAGACCTATTACTCGAGTAATAGGTCTCACCCTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_015734.2-611s21c1
Sequence:CCGGGCCTACCGAGTCTCTAAAGATCTCGAGATCTTTAGAGACTCGGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_015734.2-1017s21c1
Sequence:CCGGCCCGGATTCTGGATGATGAAACTCGAGTTTCATCATCCAGAATCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015734.1-940s1c1
Sequence:CCGGCCTATTACTATGAGTATCCATCTCGAGATGGATACTCATAGTAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_015734.1-5571s1c1
Sequence:CCGGGACATCATGTTCAACGACTTTCTCGAGAAAGTCGTTGAACATGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089998    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_015734.1-5806s1c1
Sequence:CCGGCCCAGAGAGAACAAAGGGAAACTCGAGTTTCCCTTTGTTCTCTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_015734.1-351s1c1
Sequence:CCGGGCCTACCGAGTCTCTAAAGATCTCGAGATCTTTAGAGACTCGGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_015734.1-757s1c1
Sequence:CCGGCCCGGATTCTGGATGATGAAACTCGAGTTTCATCATCCAGAATCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015734
VALIDATED
COL5A1 MISSION shRNA shRNA Plasmid DNA
collagen, type V, alpha 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000313467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_015734.2-1623s21c1
Sequence:CCGGACTACTATGACCCGTACTTTGCTCGAGCAAAGTACGGGTCATAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313468    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_015734.2-6374s21c1
Sequence:CCGGACGTGCCTTTCCGATGGATTACTCGAGTAATCCATCGGAAAGGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_015734.2-1186s21c1
Sequence:CCGGAGGAGAGGGTGAGACCTATTACTCGAGTAATAGGTCTCACCCTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_015734.2-611s21c1
Sequence:CCGGGCCTACCGAGTCTCTAAAGATCTCGAGATCTTTAGAGACTCGGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_015734.2-1017s21c1
Sequence:CCGGCCCGGATTCTGGATGATGAAACTCGAGTTTCATCATCCAGAATCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015734.1-940s1c1
Sequence:CCGGCCTATTACTATGAGTATCCATCTCGAGATGGATACTCATAGTAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_015734.1-5571s1c1
Sequence:CCGGGACATCATGTTCAACGACTTTCTCGAGAAAGTCGTTGAACATGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089998    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_015734.1-5806s1c1
Sequence:CCGGCCCAGAGAGAACAAAGGGAAACTCGAGTTTCCCTTTGTTCTCTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_015734.1-351s1c1
Sequence:CCGGGCCTACCGAGTCTCTAAAGATCTCGAGATCTTTAGAGACTCGGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_015734.1-757s1c1
Sequence:CCGGCCCGGATTCTGGATGATGAAACTCGAGTTTCATCATCCAGAATCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015734
VALIDATED
COL5A1 MISSION shRNA Lentiviral Transduction Particles
collagen, type V, alpha 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000313467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_015734.2-1623s21c1
Sequence:CCGGACTACTATGACCCGTACTTTGCTCGAGCAAAGTACGGGTCATAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313468    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_015734.2-6374s21c1
Sequence:CCGGACGTGCCTTTCCGATGGATTACTCGAGTAATCCATCGGAAAGGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_015734.2-1186s21c1
Sequence:CCGGAGGAGAGGGTGAGACCTATTACTCGAGTAATAGGTCTCACCCTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_015734.2-611s21c1
Sequence:CCGGGCCTACCGAGTCTCTAAAGATCTCGAGATCTTTAGAGACTCGGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_015734.2-1017s21c1
Sequence:CCGGCCCGGATTCTGGATGATGAAACTCGAGTTTCATCATCCAGAATCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015734.1-940s1c1
Sequence:CCGGCCTATTACTATGAGTATCCATCTCGAGATGGATACTCATAGTAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_015734.1-5571s1c1
Sequence:CCGGGACATCATGTTCAACGACTTTCTCGAGAAAGTCGTTGAACATGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089998    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_015734.1-5806s1c1
Sequence:CCGGCCCAGAGAGAACAAAGGGAAACTCGAGTTTCCCTTTGTTCTCTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_015734.1-351s1c1
Sequence:CCGGGCCTACCGAGTCTCTAAAGATCTCGAGATCTTTAGAGACTCGGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_015734.1-757s1c1
Sequence:CCGGCCCGGATTCTGGATGATGAAACTCGAGTTTCATCATCCAGAATCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks