EMAIL THIS PAGE TO A FRIEND

COL5A2

collagen, type V, alpha 2

159 Gene Product Result for
Gene ID:
Human(1290) Summary: This gene encodes an alpha chain for one of the low abundance fibrillar collagens. Fibrillar collagen molecules are trimers that can be composed of one or more types of alpha chains. Type V collagen is found in tissues containing type I collagen and appears to regulate the assembly of heterotypic fibers composed of both type I and type V collagen. This gene product is closely related to type XI collagen and it is possible that the collagen chains of types V and XI constitute a single collagen type with tissue-specific chain combinations. Mutations in this gene are associated with Ehlers-Danlos syndrome, types I and II. [provided by RefSeq, Jul 2008]
Mouse(12832) collagen, type V, alpha 2
Rat(85250) collagen, type V, alpha 2
chicken(423986) collagen, type V, alpha 2
domestic cat(101100072) collagen, type V, alpha 2
cow(538590) collagen, type V, alpha 2
Horse(100054421) collagen, type V, alpha 2
dog(478836) collagen, type V, alpha 2
domestic guinea pig(100726156) collagen, type V, alpha 2
naked mole-rat(101706649) collagen, type V, alpha 2
sheep(101114493) collagen, type V, alpha 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007737 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007737 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007737 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000393 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000393 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000393 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000393 Rosetta Predictions human pricing
XM_001061982 Rosetta Predictions rat pricing
XM_343564 Rosetta Predictions rat pricing
NM_007737 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000393 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00302465 predicted 4728
2 SASI_Hs01_00217700 predicted 4739
3 SASI_Hs02_00302466 predicted 4322
4 SASI_Hs01_00217702 predicted 4671
5 SASI_Hs01_00217703 predicted 1193
6 SASI_Hs01_00217704 predicted 279
7 SASI_Hs01_00217705 predicted 4157
8 SASI_Hs01_00217706 predicted 4222
9 SASI_Hs01_00217707 predicted 4814
10 SASI_Hs01_00217708 predicted 3109
11 SASI_Hs01_00217699 predicted 4238
12 SASI_Hs01_00217701 predicted 4184
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001061982 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00301995 predicted 4912
2 SASI_Rn02_00301996 predicted 4679
3 SASI_Rn02_00301997 predicted 4340
4 SASI_Rn02_00301998 predicted 4508
5 SASI_Rn02_00301999 predicted 732
6 SASI_Rn02_00302000 predicted 4636
7 SASI_Rn02_00302001 predicted 4587
8 SASI_Rn02_00302002 predicted 4070
9 SASI_Rn02_00302003 predicted 395
10 SASI_Rn02_00302004 predicted 4369
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343564 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00396058 predicted 4913
2 SASI_Rn02_00396059 predicted 4680
3 SASI_Rn02_00396060 predicted 4338
4 SASI_Rn02_00396061 predicted 4504
5 SASI_Rn02_00396062 predicted 4633
6 SASI_Rn02_00396063 predicted 4579
7 SASI_Rn02_00396064 predicted 4067
8 SASI_Rn02_00396065 predicted 396
9 SASI_Rn02_00396066 predicted 4369
10 SASI_Rn02_00396067 predicted 4575
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007737 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00093602 predicted 4238
2 SASI_Mm01_00093604 predicted 4320
3 SASI_Mm01_00093605 predicted 482
4 SASI_Mm01_00093607 predicted 4053
5 SASI_Mm02_00312333 predicted 4891
6 SASI_Mm01_00093608 predicted 4816
7 SASI_Mm01_00093609 predicted 710
8 SASI_Mm01_00093610 predicted 4613
9 SASI_Mm01_00093611 predicted 4360
10 SASI_Mm02_00312334 predicted 4750
11 SASI_Mm01_00093603 predicted 4675
12 SASI_Mm01_00093606 predicted 4829
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007737
COL5A2 MISSION shRNA Bacterial Glycerol Stock
collagen, type V, alpha 2
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000090830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007737.1-2964s1c1
Sequence:CCGGGCAAAGAGGAATTGTTGGAATCTCGAGATTCCAACAATTCCTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007737.1-3872s1c1
Sequence:CCGGCCCGCACTTGTGATGATTTAACTCGAGTTAAATCATCACAAGTGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007737.1-346s1c1
Sequence:CCGGCCAGGATTAGTGCCTGTTGTACTCGAGTACAACAGGCACTAATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007737.1-4219s1c1
Sequence:CCGGGTTGGATATATGGATGATCAACTCGAGTTGATCATCCATATATCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007737.1-1456s1c1
Sequence:CCGGCATGGTATTCAGGGTCCCATTCTCGAGAATGGGACCCTGAATACCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007737.2-422s21c1
Sequence:CCGGAGGGTACTGTGTCTCAATAAACTCGAGTTTATTGAGACACAGTACCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421693    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007737.2-5005s21c1
Sequence:CCGGACCTTATCCTTCAGAATATTTCTCGAGAAATATTCTGAAGGATAAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007737
COL5A2 MISSION shRNA shRNA Plasmid DNA
collagen, type V, alpha 2
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000090830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007737.1-2964s1c1
Sequence:CCGGGCAAAGAGGAATTGTTGGAATCTCGAGATTCCAACAATTCCTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007737.1-3872s1c1
Sequence:CCGGCCCGCACTTGTGATGATTTAACTCGAGTTAAATCATCACAAGTGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007737.1-346s1c1
Sequence:CCGGCCAGGATTAGTGCCTGTTGTACTCGAGTACAACAGGCACTAATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007737.1-4219s1c1
Sequence:CCGGGTTGGATATATGGATGATCAACTCGAGTTGATCATCCATATATCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007737.1-1456s1c1
Sequence:CCGGCATGGTATTCAGGGTCCCATTCTCGAGAATGGGACCCTGAATACCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007737.2-422s21c1
Sequence:CCGGAGGGTACTGTGTCTCAATAAACTCGAGTTTATTGAGACACAGTACCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421693    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007737.2-5005s21c1
Sequence:CCGGACCTTATCCTTCAGAATATTTCTCGAGAAATATTCTGAAGGATAAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007737
COL5A2 MISSION shRNA Lentiviral Transduction Particles
collagen, type V, alpha 2
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000090830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007737.1-2964s1c1
Sequence:CCGGGCAAAGAGGAATTGTTGGAATCTCGAGATTCCAACAATTCCTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007737.1-3872s1c1
Sequence:CCGGCCCGCACTTGTGATGATTTAACTCGAGTTAAATCATCACAAGTGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007737.1-346s1c1
Sequence:CCGGCCAGGATTAGTGCCTGTTGTACTCGAGTACAACAGGCACTAATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007737.1-4219s1c1
Sequence:CCGGGTTGGATATATGGATGATCAACTCGAGTTGATCATCCATATATCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007737.1-1456s1c1
Sequence:CCGGCATGGTATTCAGGGTCCCATTCTCGAGAATGGGACCCTGAATACCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007737.2-422s21c1
Sequence:CCGGAGGGTACTGTGTCTCAATAAACTCGAGTTTATTGAGACACAGTACCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421693    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007737.2-5005s21c1
Sequence:CCGGACCTTATCCTTCAGAATATTTCTCGAGAAATATTCTGAAGGATAAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000393
VALIDATED
COL5A2 MISSION shRNA Bacterial Glycerol Stock
collagen, type V, alpha 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000083982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000393.2-4169s1c1
Sequence:CCGGCCATCCAGTGTACCACGTAAACTCGAGTTTACGTGGTACACTGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000393.2-3617s1c1
Sequence:CCGGCCTGGTCCAAATGGTGAACAACTCGAGTTGTTCACCATTTGGACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_000393.2-1952s1c1
Sequence:CCGGCCAGGCTCCATAGGAATCAAACTCGAGTTTGATTCCTATGGAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000393.2-4617s1c1
Sequence:CCGGGCGTTGAAATTGGGCCAGTTTCTCGAGAAACTGGCCCAATTTCAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000393.3-329s21c1
Sequence:CCGGAGGGCAATTTGTCTCAATAAACTCGAGTTTATTGAGACAAATTGCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000393.3-888s21c1
Sequence:CCGGGGGAGTCAAGTAGGACTAATGCTCGAGCATTAGTCCTACTTGACTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000393.3-3814s21c1
Sequence:CCGGCAGTTGGTCCTTCAGGTAAAGCTCGAGCTTTACCTGAAGGACCAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000393.3-4377s21c1
Sequence:CCGGAGAGGGTCTCAGTTCGCTTATCTCGAGATAAGCGAACTGAGACCCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000393
VALIDATED
COL5A2 MISSION shRNA shRNA Plasmid DNA
collagen, type V, alpha 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000083982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000393.2-4169s1c1
Sequence:CCGGCCATCCAGTGTACCACGTAAACTCGAGTTTACGTGGTACACTGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000393.2-3617s1c1
Sequence:CCGGCCTGGTCCAAATGGTGAACAACTCGAGTTGTTCACCATTTGGACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_000393.2-1952s1c1
Sequence:CCGGCCAGGCTCCATAGGAATCAAACTCGAGTTTGATTCCTATGGAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000393.2-4617s1c1
Sequence:CCGGGCGTTGAAATTGGGCCAGTTTCTCGAGAAACTGGCCCAATTTCAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000393.3-329s21c1
Sequence:CCGGAGGGCAATTTGTCTCAATAAACTCGAGTTTATTGAGACAAATTGCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000393.3-888s21c1
Sequence:CCGGGGGAGTCAAGTAGGACTAATGCTCGAGCATTAGTCCTACTTGACTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000393.3-3814s21c1
Sequence:CCGGCAGTTGGTCCTTCAGGTAAAGCTCGAGCTTTACCTGAAGGACCAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000393.3-4377s21c1
Sequence:CCGGAGAGGGTCTCAGTTCGCTTATCTCGAGATAAGCGAACTGAGACCCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000393
VALIDATED
COL5A2 MISSION shRNA Lentiviral Transduction Particles
collagen, type V, alpha 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000083982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000393.2-4169s1c1
Sequence:CCGGCCATCCAGTGTACCACGTAAACTCGAGTTTACGTGGTACACTGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000393.2-3617s1c1
Sequence:CCGGCCTGGTCCAAATGGTGAACAACTCGAGTTGTTCACCATTTGGACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_000393.2-1952s1c1
Sequence:CCGGCCAGGCTCCATAGGAATCAAACTCGAGTTTGATTCCTATGGAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000393.2-4617s1c1
Sequence:CCGGGCGTTGAAATTGGGCCAGTTTCTCGAGAAACTGGCCCAATTTCAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000393.3-329s21c1
Sequence:CCGGAGGGCAATTTGTCTCAATAAACTCGAGTTTATTGAGACAAATTGCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000393.3-888s21c1
Sequence:CCGGGGGAGTCAAGTAGGACTAATGCTCGAGCATTAGTCCTACTTGACTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000393.3-3814s21c1
Sequence:CCGGCAGTTGGTCCTTCAGGTAAAGCTCGAGCTTTACCTGAAGGACCAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000393.3-4377s21c1
Sequence:CCGGAGAGGGTCTCAGTTCGCTTATCTCGAGATAAGCGAACTGAGACCCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks